Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24337
Trapped Gene
Taok2 (ENSMUSG00000059981)
Vector Insertion
Chr 7: 134024010 - 134024178
Public Clones not available
Private Clones OST224437 (lexicon) OST207189 (lexicon) OST42626 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716761 (Chr7:134024011..134024177 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGGATGACCCTGAGAAGC Chr7:134024064..134024083 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716761 (Chr7:134024011..134024177 -)
Downstram Exon
ENSMUSE00000373009 (Chr7:134024011..134024177 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGGATGACCCTGAGAAGC Chr7:134024064..134024083 59.8 55 GCTTCTCAGGGTCATCCTTG Chr7:134024042..134024061 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000420139 Chr7:134027420..134028185 CCTCCGCTACAGTCCTTCAG Chr7:134028058..134028077 60.01 60
upstream ENSMUSE00000718977 Chr7:134027420..134028217 CCTCCGCTACAGTCCTTCAG Chr7:134028058..134028077 60.01 60
upstream ENSMUSE00000373009 Chr7:134024011..134024177 CAAGGATGACCCTGAGAAGC Chr7:134024064..134024083 59.8 55
upstream ENSMUSE00000716761 Chr7:134024011..134024177 CAAGGATGACCCTGAGAAGC Chr7:134024064..134024083 59.8 55

*** Putative Vector Insertion (Chr 7: 134024010 - 134024178) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000495869 Chr7:134023762..134023833 ACCTCACTGTTCCGGACATC Chr7:134023786..134023805 59.97 55
downstream ENSMUSE00000292653 Chr7:134023566..134023667 AGAACCGCACTTCCTTGATG Chr7:134023612..134023631 60.26 50
downstream ENSMUSE00000292645 Chr7:134022921..134022966 CCCAGGCAATACTCCATCAC Chr7:134022922..134022941 60.34 55
downstream ENSMUSE00000516891 Chr7:134022705..134022801 GGGTCACAGCTGCAATCTCT Chr7:134022735..134022754 60.42 55
downstream ENSMUSE00000292629 Chr7:134022434..134022547 ATTGACGCAGAGCCAAAGTC Chr7:134022451..134022470 60.41 50
downstream ENSMUSE00000478418 Chr7:134022237..134022328 TCCATGGCTAGGATCACCTC Chr7:134022277..134022296 60.03 55
downstream ENSMUSE00000292616 Chr7:134019540..134019633 TGTTGAACAGTGGTGGCTTC Chr7:134019585..134019604 59.73 50
downstream ENSMUSE00000482802 Chr7:134019367..134019448 TGAGGTTGGTCTGTCTTGAGG Chr7:134019360..134019380 60.28 52.38
downstream ENSMUSE00000477036 Chr7:134018571..134018738 GTTCCCGTACAGCATCCTTG Chr7:134018638..134018657 60.52 55
downstream ENSMUSE00000498688 Chr7:134018163..134018447 CATGGCCATCTCTCTGGATT Chr7:134018198..134018217 60.03 50
downstream ENSMUSE00000292597 Chr7:134017812..134017970 GGGTCATCTCTGGCTGGTAG Chr7:134017903..134017922 59.68 60
downstream ENSMUSE00000292590 Chr7:134015711..134016076 CTTCCGCAGCTTGTAGGTTC Chr7:134015704..134015723 60.01 55
downstream ENSMUSE00000292583 Chr7:134015420..134015623 TGTTGCAACTGCTCCTTTTG Chr7:134015525..134015544 60.03 45
downstream ENSMUSE00000352119 Chr7:134014916..134015155 GCTTCTGCCGTAATTCTTGC Chr7:134014932..134014951 59.99 50
downstream ENSMUSE00000716091 Chr7:134013017..134015155 GCTTCTGCCGTAATTCTTGC Chr7:134014932..134014951 59.99 50
downstream ENSMUSE00000527170 Chr7:134011624..134011836 ATACTGCTCAGCCAGGATCG Chr7:134011638..134011657 60.38 55
downstream ENSMUSE00000351419 Chr7:134010511..134010693 ACTCTGCCTCTTGGGTCTCA Chr7:134010641..134010660 59.99 55
downstream ENSMUSE00000527169 Chr7:134009911..134010429 GCTCAAGCAAACTCCGGATA Chr7:134010344..134010363 60.35 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCTGGGCCCTATCTTAG Chr7:134024204..134024224 60.05 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTCTGGGCCCTATCTTAG Chr7:134024204..134024224 60.05 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059981