Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24338
Trapped Gene
Trim26 (ENSMUSG00000024457)
Vector Insertion
Chr 17: 36993717 - 36993933
Public Clones not available
Private Clones OST224422 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142421 (Chr17:36993601..36993716 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACGGAAGAAGTTCTGGAT Chr17:36993605..36993624 59.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142421 (Chr17:36993601..36993716 +)
Downstram Exon
ENSMUSE00000142425 (Chr17:36993934..36993966 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACGGAAGAAGTTCTGGAT Chr17:36993605..36993624 59.14 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000142415 Chr17:36974086..36974209 CTGCTTGCTCAGGACCTACC Chr17:36974139..36974158 60.01 60
upstream ENSMUSE00000142419 Chr17:36974410..36974517 No primer for this exon
upstream ENSMUSE00000142423 Chr17:36987601..36988073 GCTCTGCAAGAAGCCCTTTA Chr17:36987797..36987816 59.73 50
upstream ENSMUSE00000142427 Chr17:36988172..36988267 AAGCCAAGGGAGAAGCTGAT Chr17:36988233..36988252 60.35 50
upstream ENSMUSE00000358341 Chr17:36989408..36989638 TTTCTAAAGAAGCGGGAGCA Chr17:36989465..36989484 60.09 45
upstream ENSMUSE00000696655 Chr17:36991229..36991246 No primer for this exon
upstream ENSMUSE00000543796 Chr17:36991570..36991656 CCTGTTCCTATTGCCTCCTG Chr17:36991612..36991631 59.69 55
upstream ENSMUSE00000142417 Chr17:36993147..36993169 No primer for this exon
upstream ENSMUSE00000142421 Chr17:36993601..36993716 CCACGGAAGAAGTTCTGGAT Chr17:36993605..36993624 59.14 50

*** Putative Vector Insertion (Chr 17: 36993717 - 36993933) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142425 Chr17:36993934..36993966 No primer for this exon
downstream ENSMUSE00000478931 Chr17:36994345..36996325 GTGAAGGTGGTCGTGAAGGT Chr17:36994966..36994985 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGTAAGCATTGGGAAAA Chr17:36993714..36993734 59.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGTAAGCATTGGGAAAA Chr17:36993714..36993734 59.93 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024457