Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24339
Trapped Gene
Ptdss2 (ENSMUSG00000025495)
Vector Insertion
Chr 7: 148338788 - 148338873
Public Clones not available
Private Clones OST224417 (lexicon) OST98489 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151156 (Chr7:148338674..148338787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGATCCGTGACTGGTGGAT Chr7:148338680..148338699 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151156 (Chr7:148338674..148338787 +)
Downstram Exon
ENSMUSE00000151154 (Chr7:148338874..148338992 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGATCCGTGACTGGTGGAT Chr7:148338680..148338699 60.21 50 GAGGGTCTTCATGCCACAGT Chr7:148338936..148338955 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341756 Chr7:148317185..148317416 ACGACGATGGCACTAACACC Chr7:148317389..148317408 60.99 55
upstream ENSMUSE00000151152 Chr7:148321208..148321309 CTGGGCTACGTGACTCTCCT Chr7:148321251..148321270 59.47 60
upstream ENSMUSE00000151160 Chr7:148328992..148329074 AAGCTAAAGACGGGCCATTT Chr7:148329039..148329058 60.1 45
upstream ENSMUSE00000151153 Chr7:148332980..148333047 CGGTTTTGGCTGTGTGTTAG Chr7:148332988..148333007 59.24 50
upstream ENSMUSE00000151158 Chr7:148337549..148337683 ATGGCCGACAGTTTCTGAAG Chr7:148337559..148337578 60.26 50
upstream ENSMUSE00000151150 Chr7:148338091..148338141 GCACACTTCATTGGCTGGTA Chr7:148338115..148338134 59.72 50
upstream ENSMUSE00000151156 Chr7:148338674..148338787 ATGATCCGTGACTGGTGGAT Chr7:148338680..148338699 60.21 50

*** Putative Vector Insertion (Chr 7: 148338788 - 148338873) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151154 Chr7:148338874..148338992 GAGGGTCTTCATGCCACAGT Chr7:148338936..148338955 60.12 55
downstream ENSMUSE00000151155 Chr7:148340252..148340366 GCTTCCACTCAAAGCGTACC Chr7:148340319..148340338 59.88 55
downstream ENSMUSE00000151149 Chr7:148340456..148340601 CACGTTCACGAAGAAGACCA Chr7:148340560..148340579 59.87 50
downstream ENSMUSE00000151151 Chr7:148340710..148340895 GCAGTGACAGGGTGAGTGTG Chr7:148340822..148340841 60.37 60
downstream ENSMUSE00000631812 Chr7:148341233..148342053 CCAAGATACCTCCCCTAGCC Chr7:148341727..148341746 59.92 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCATCTCATAATCGCCTTGC Chr7:148338830..148338851 59.69 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTCACGTGACTGGGAAA Chr7:148338832..148338852 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025495