Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24356
Trapped Gene
Tfdp1 (ENSMUSG00000038482)
Vector Insertion
Chr 8: 13338921 - 13339664
Public Clones not available
Private Clones OST223762 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610192 (Chr8:13338806..13338920 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610192 (Chr8:13338806..13338920 +)
Downstram Exon
ENSMUSE00000469325 (Chr8:13339665..13339739 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AACTGCGTACCCTCCACAGA Chr8:13339702..13339721 60.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610192 Chr8:13338806..13338920 No primer for this exon

*** Putative Vector Insertion (Chr 8: 13338921 - 13339664) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000469325 Chr8:13339665..13339739 AACTGCGTACCCTCCACAGA Chr8:13339702..13339721 60.71 55
downstream ENSMUSE00000455008 Chr8:13357043..13357109 TTAGTTCTCCGTTGGCTTCAA Chr8:13357075..13357095 59.87 42.86
downstream ENSMUSE00000455017 Chr8:13365089..13365195 CATTGGACTGTCCGAAGGTT Chr8:13365178..13365197 59.97 50
downstream ENSMUSE00000272558 Chr8:13369459..13369580 ACAAAATGCGTGTTGGGAGT Chr8:13369541..13369560 60.42 45
downstream ENSMUSE00000514215 Chr8:13370481..13370646 ATTCTTCTCGCCCTTCCTGT Chr8:13370511..13370530 60.21 50
downstream ENSMUSE00000272546 Chr8:13370879..13371022 AAGTTCTGGCACTCCTGAGC Chr8:13371021..13371040 59.6 55
downstream ENSMUSE00000272513 Chr8:13371352..13371420 TGGAGCTGTGACTGCTTCTG Chr8:13371407..13371426 60.33 55
downstream ENSMUSE00000272506 Chr8:13372466..13372617 ATGAAGGGCAAGTGGATGAC Chr8:13372566..13372585 59.93 50
downstream ENSMUSE00000272500 Chr8:13372936..13373102 CATCGTGGATCTCAAACGTG Chr8:13372985..13373004 60.11 50
downstream ENSMUSE00000272493 Chr8:13373845..13373923 CGTGACGAATACTCCACCAA Chr8:13373885..13373904 59.57 50
downstream ENSMUSE00000472934 Chr8:13377142..13378446 CAACTGTTGAGGGGCAAAAT Chr8:13377613..13377632 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:13338972..13338992 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000038482