Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24360
Trapped Gene
Elavl1 (ENSMUSG00000040028)
Vector Insertion
Chr 8: 4301839 - 4304926
Public Clones not available
Private Clones OST223602 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229435 (Chr8:4304927..4305030 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACACTGAACGGCTTGAGAC Chr8:4304947..4304966 59.47 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229435 (Chr8:4304927..4305030 -)
Downstram Exon
ENSMUSE00000229429 (Chr8:4301685..4301838 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACACTGAACGGCTTGAGAC Chr8:4304947..4304966 59.47 55 AGTTGATGATTCGCCCAAAC Chr8:4301690..4301709 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638320 Chr8:4324886..4325086 No primer for this exon
upstream ENSMUSE00000706646 Chr8:4324886..4324906 No primer for this exon
upstream ENSMUSE00000706645 Chr8:4312557..4312614 No primer for this exon
upstream ENSMUSE00000229444 Chr8:4311599..4311786 ACGAAGTCTGTTCAGCAGCA Chr8:4311644..4311663 59.78 50
upstream ENSMUSE00000229435 Chr8:4304927..4305030 CACACTGAACGGCTTGAGAC Chr8:4304947..4304966 59.47 55

*** Putative Vector Insertion (Chr 8: 4301839 - 4304926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000229429 Chr8:4301685..4301838 AGTTGATGATTCGCCCAAAC Chr8:4301690..4301709 59.94 45
downstream ENSMUSE00000278547 Chr8:4295336..4295561 CTGCTTCTGACCGTTTGTCA Chr8:4295489..4295508 60.03 50
downstream ENSMUSE00000638319 Chr8:4288347..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50
downstream ENSMUSE00000706644 Chr8:4288344..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACACTGAACGGCTTGAGAC Chr8:4304945..4304965 59.47 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACACTGAACGGCTTGAGAC Chr8:4304945..4304965 59.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040028