Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24379
Trapped Gene
Sumf2 (ENSMUSG00000025538)
Vector Insertion
Chr 5: 130325934 - 130328749
Public Clones IST14811D11 (tigm)
Private Clones OST222986 (lexicon) OST222021 (lexicon) OST180370 (lexicon) OST178844 (lexicon)
OST68064 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000592012 (Chr5:130325777..130325933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTTTGCCATCGACATATT Chr5:130325890..130325909 59.78 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000592012 (Chr5:130325777..130325933 +)
Downstram Exon
ENSMUSE00000504188 (Chr5:130328750..130328861 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTTTGCCATCGACATATT Chr5:130325890..130325909 59.78 45 CCTCAAAGACGAAGCTCCAC Chr5:130328820..130328839 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000592013 Chr5:130322872..130322962 ATGCGCTCTGAGTTCTGGTT Chr5:130322872..130322891 60.02 50
upstream ENSMUSE00000592012 Chr5:130325777..130325933 CCCTTTGCCATCGACATATT Chr5:130325890..130325909 59.78 45

*** Putative Vector Insertion (Chr 5: 130325934 - 130328749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000504188 Chr5:130328750..130328861 CCTCAAAGACGAAGCTCCAC Chr5:130328820..130328839 59.99 55
downstream ENSMUSE00000504952 Chr5:130329899..130329943 No primer for this exon
downstream ENSMUSE00000505982 Chr5:130330564..130330714 CTCCAGTTTCTCTCGGATGC Chr5:130330605..130330624 59.95 55
downstream ENSMUSE00000311153 Chr5:130334116..130334171 GTTCCCCCATGGATAAACCT Chr5:130334141..130334160 59.88 50
downstream ENSMUSE00000311144 Chr5:130335713..130335797 TTTGTCACCTTTGGGGAACT Chr5:130335739..130335758 59.42 45
downstream ENSMUSE00000151506 Chr5:130335946..130336090 GGTTGGTATGTGGACGCTGT Chr5:130336003..130336022 60.84 55
downstream ENSMUSE00000378483 Chr5:130338515..130339928 TGCAGTCCGAGTGTTCTTTG Chr5:130338750..130338769 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCCTTTGCCATCGACATA Chr5:130325889..130325909 60.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCTTTGCCATCGACATA Chr5:130325889..130325909 60.33 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025538