Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24387
Trapped Gene
Tle3 (ENSMUSG00000032280)
Vector Insertion
Chr 9: 61221861 - 61222321
Public Clones not available
Private Clones OST222526 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000353253 (Chr9:61221760..61221860 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATTCACTGTGGCCGAGTC Chr9:61221790..61221809 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000353253 (Chr9:61221760..61221860 +)
Downstram Exon
ENSMUSE00000533246 (Chr9:61222322..61222385 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATTCACTGTGGCCGAGTC Chr9:61221790..61221809 60.12 50 TCTCGTTAGCCAGCTTGTCA Chr9:61222359..61222378 59.74 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000429583 Chr9:61220665..61221268 CCTCATCGTCCTGATTGACC Chr9:61220832..61220851 60.47 55
upstream ENSMUSE00000353253 Chr9:61221760..61221860 AAATTCACTGTGGCCGAGTC Chr9:61221790..61221809 60.12 50

*** Putative Vector Insertion (Chr 9: 61221861 - 61222321) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000533246 Chr9:61222322..61222385 TCTCGTTAGCCAGCTTGTCA Chr9:61222359..61222378 59.74 50
downstream ENSMUSE00000533245 Chr9:61223336..61223380 ATTCAAGCCATAGGACATCTCA Chr9:61223363..61223384 58.67 40.91
downstream ENSMUSE00000223757 Chr9:61241010..61241072 AAAAGGCATGATCTGGGCTA Chr9:61241063..61241082 59.67 45
downstream ENSMUSE00000533207 Chr9:61242415..61242489 GTTCAACTCCGTCATGGTGA Chr9:61242480..61242499 59.53 50
downstream ENSMUSE00000223733 Chr9:61249660..61249864 TCCAGTTCATGGTGGTTCTTC Chr9:61249858..61249878 59.96 47.62
downstream ENSMUSE00000697758 Chr9:61251259..61251275 No primer for this exon
downstream ENSMUSE00000223692 Chr9:61255161..61255280 GTCTTTCTCTTCCGCCTTCC Chr9:61255268..61255287 60.33 55
downstream ENSMUSE00000218336 Chr9:61256087..61256137 CTCTTGTCCCCATCGCTATC Chr9:61256109..61256128 59.65 55
downstream ENSMUSE00000218335 Chr9:61256573..61256725 CCAAGGTCTTTGGTCTTGGA Chr9:61256724..61256743 60.08 50
downstream ENSMUSE00000429558 Chr9:61257082..61257223 TTGGTGTGTTGGACTTGAGC Chr9:61257127..61257146 59.73 50
downstream ENSMUSE00000429556 Chr9:61257743..61257942 GCTGGATAGGAGCTGGTGAG Chr9:61257791..61257810 59.97 60
downstream ENSMUSE00000218331 Chr9:61259070..61259146 No primer for this exon
downstream ENSMUSE00000533231 Chr9:61260072..61260321 TGGCTGAGCGTATTGATCTG Chr9:61260191..61260210 59.97 50
downstream ENSMUSE00000533227 Chr9:61260662..61260909 ACGAGCGGATGTAGTTGTCC Chr9:61260689..61260708 60.14 55
downstream ENSMUSE00000533225 Chr9:61261750..61261897 CTGGGAGGTGAAATCGTGTT Chr9:61261900..61261919 59.97 50
downstream ENSMUSE00000533222 Chr9:61262518..61262668 ATTTGTCGGGCTTAGTGTGG Chr9:61262617..61262636 59.99 50
downstream ENSMUSE00000533219 Chr9:61263369..61263445 CCAGGCATTGAGAAGGTTGT Chr9:61263418..61263437 60.11 50
downstream ENSMUSE00000475763 Chr9:61264416..61266288 AGAAAAGCCACCACCATGAG Chr9:61265055..61265074 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGTTCCTGCAAGCTCAGT Chr9:61221835..61221855 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGCAAGCTCAGTATCACA Chr9:61221840..61221861 59.61 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032280