Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24392
Trapped Gene
Nlrp9a (ENSMUSG00000054102)
Vector Insertion
Chr 7: 27353023 - 27355525
Public Clones not available
Private Clones OST222361 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000492928 (Chr7:27352852..27353022 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATCTGGGGTCAAATTTCC Chr7:27352933..27352952 59.73 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000492928 (Chr7:27352852..27353022 +)
Downstram Exon
ENSMUSE00000535759 (Chr7:27355526..27355696 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATCTGGGGTCAAATTTCC Chr7:27352933..27352952 59.73 45 CAAGTCAGGACAGCCGAGAT Chr7:27355588..27355607 60.41 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676587 Chr7:27320084..27320129 No primer for this exon
upstream ENSMUSE00000535761 Chr7:27335793..27336101 CAATCGGGAAGACCTCTCAA Chr7:27336058..27336077 60.19 50
upstream ENSMUSE00000713470 Chr7:27335831..27336101 CAATCGGGAAGACCTCTCAA Chr7:27336058..27336077 60.19 50
upstream ENSMUSE00000505261 Chr7:27342249..27343830 CAGGACAAACCTGTGCAATG Chr7:27342685..27342704 60.15 50
upstream ENSMUSE00000676586 Chr7:27345694..27345858 GCCAAGCATTGGACTACGTT Chr7:27345701..27345720 60.14 50
upstream ENSMUSE00000506165 Chr7:27347465..27347629 TCAACATGTGGAGTGGAGGA Chr7:27347604..27347623 60.09 50
upstream ENSMUSE00000503488 Chr7:27349859..27350026 CAAGTGAGGCTTGTGGCATA Chr7:27349879..27349898 59.86 50
upstream ENSMUSE00000492928 Chr7:27352852..27353022 TGATCTGGGGTCAAATTTCC Chr7:27352933..27352952 59.73 45

*** Putative Vector Insertion (Chr 7: 27353023 - 27355525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000535759 Chr7:27355526..27355696 CAAGTCAGGACAGCCGAGAT Chr7:27355588..27355607 60.41 55
downstream ENSMUSE00000424482 Chr7:27356259..27356429 CCTCCAGGTTACAGGCTTTG Chr7:27356425..27356444 59.73 55
downstream ENSMUSE00000424476 Chr7:27358822..27358951 CCCCTCTTTTCGAGTTCCTC Chr7:27358944..27358963 60.18 55
downstream ENSMUSE00000535758 Chr7:27358822..27359163 TGCTGTTCCATACCAGACGA Chr7:27358967..27358986 60.26 50
downstream ENSMUSE00000711010 Chr7:27358822..27358972 TACCAGACGAACACCCCTCT Chr7:27358957..27358976 59.57 55
downstream ENSMUSE00000424469 Chr7:27360111..27360183 GCCCTCTCAACCTCCAAAAG Chr7:27360136..27360155 61.12 55
downstream ENSMUSE00000715165 Chr7:27360570..27360634 ACTGTGCCTCCAGTGGATCT Chr7:27360621..27360640 59.71 55
downstream ENSMUSE00000717694 Chr7:27360570..27360634 ACTGTGCCTCCAGTGGATCT Chr7:27360621..27360640 59.71 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACCCTCAAGGAGTTATGG Chr7:27353005..27353025 59.55 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACCCTCAAGGAGTTATGG Chr7:27353005..27353025 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054102