Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24394
Trapped Gene
Rps23 (ENSMUSG00000049517)
Vector Insertion
Chr 13: 91064052 - 91064141
Public Clones not available
Private Clones OST222227 (lexicon) OST196735 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487946 (Chr13:91063931..91064051 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGGGAAGAAGATCACAGC Chr13:91063995..91064014 59.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487946 (Chr13:91063931..91064051 +)
Downstram Exon
ENSMUSE00000519512 (Chr13:91064142..91064329 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGGGAAGAAGATCACAGC Chr13:91063995..91064014 59.29 50 CACCTTAAAGCGGACTCCAG Chr13:91064225..91064244 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000229067 Chr13:91062770..91062804 No primer for this exon
upstream ENSMUSE00000488780 Chr13:91063192..91063351 AAGTGTCGTGGTCTCCGAAC Chr13:91063194..91063213 60.16 55
upstream ENSMUSE00000487946 Chr13:91063931..91064051 AACGGGAAGAAGATCACAGC Chr13:91063995..91064014 59.29 50

*** Putative Vector Insertion (Chr 13: 91064052 - 91064141) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000519512 Chr13:91064142..91064329 CACCTTAAAGCGGACTCCAG Chr13:91064225..91064244 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCTGCCTGAACTTCATT Chr13:91064030..91064050 59.7 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGCTGCCTGAACTTCATT Chr13:91064030..91064050 59.7 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049517