Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24400
Trapped Gene
Acsl1 (ENSMUSG00000018796)
Vector Insertion
Chr 8: 47578185 - 47578381
Public Clones not available
Private Clones OST222102 (lexicon) OST67212 (lexicon) OST56743 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712407 (Chr8:47578154..47578380 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712407 (Chr8:47578154..47578380 +)
Downstram Exon
ENSMUSE00000683690 (Chr8:47578186..47578380 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000582394 Chr8:47556396..47556584 No primer for this exon
upstream ENSMUSE00000683692 Chr8:47576328..47576515 No primer for this exon
upstream ENSMUSE00000268875 Chr8:47578154..47578380 No primer for this exon
upstream ENSMUSE00000712407 Chr8:47578154..47578380 No primer for this exon

*** Putative Vector Insertion (Chr 8: 47578185 - 47578381) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683690 Chr8:47578186..47578380 No primer for this exon
downstream ENSMUSE00000211338 Chr8:47591003..47591120 No primer for this exon
downstream ENSMUSE00000582393 Chr8:47593687..47593751 No primer for this exon
downstream ENSMUSE00000211330 Chr8:47596714..47596815 No primer for this exon
downstream ENSMUSE00000211337 Chr8:47598645..47598744 No primer for this exon
downstream ENSMUSE00000211327 Chr8:47598927..47599105 No primer for this exon
downstream ENSMUSE00000211323 Chr8:47603622..47603654 No primer for this exon
downstream ENSMUSE00000582392 Chr8:47603803..47603854 No primer for this exon
downstream ENSMUSE00000211335 Chr8:47604315..47604388 No primer for this exon
downstream ENSMUSE00000582391 Chr8:47606622..47606699 No primer for this exon
downstream ENSMUSE00000683689 Chr8:47606764..47606841 No primer for this exon
downstream ENSMUSE00000211340 Chr8:47610297..47610431 No primer for this exon
downstream ENSMUSE00000211329 Chr8:47611598..47611732 No primer for this exon
downstream ENSMUSE00000211339 Chr8:47612544..47612639 No primer for this exon
downstream ENSMUSE00000211326 Chr8:47613934..47614006 No primer for this exon
downstream ENSMUSE00000211336 Chr8:47615741..47615829 No primer for this exon
downstream ENSMUSE00000211320 Chr8:47616324..47616440 No primer for this exon
downstream ENSMUSE00000268771 Chr8:47617142..47617285 No primer for this exon
downstream ENSMUSE00000211332 Chr8:47618720..47618821 No primer for this exon
downstream ENSMUSE00000211328 Chr8:47618919..47618990 No primer for this exon
downstream ENSMUSE00000430422 Chr8:47619694..47621404 No primer for this exon
downstream ENSMUSE00000683688 Chr8:47619694..47619834 No primer for this exon
downstream ENSMUSE00000683691 Chr8:47619694..47620935 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGAACCACCAACCCAGAA Chr8:47578165..47578185 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGAACCACCAACCCAGAA Chr8:47578165..47578185 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018796