Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24402
Trapped Gene
Impdh2 (ENSMUSG00000062867)
Vector Insertion
Chr 9: 108463414 - 108463927
Public Clones not available
Private Clones OST222034 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634272 (Chr9:108463365..108463413 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634272 (Chr9:108463365..108463413 +)
Downstram Exon
ENSMUSE00000486948 (Chr9:108463928..108464029 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGAAACCAATGGGGTCTTT Chr9:108463985..108464004 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486405 Chr9:108462800..108462962 GTCATGGCGGACTACCTGAT Chr9:108462862..108462881 59.96 55
upstream ENSMUSE00000634272 Chr9:108463365..108463413 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108463414 - 108463927) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000486948 Chr9:108463928..108464029 AGGAAACCAATGGGGTCTTT Chr9:108463985..108464004 59.67 45
downstream ENSMUSE00000478637 Chr9:108464114..108464188 GTTGTGGTGGATGAAACCAA Chr9:108464149..108464168 59.24 45
downstream ENSMUSE00000472571 Chr9:108464505..108464711 GTACACGATCCTTGGGGCTA Chr9:108464565..108464584 59.96 55
downstream ENSMUSE00000634268 Chr9:108465123..108465210 TGCAGAATCTCATTTGCCTCT Chr9:108465198..108465218 59.97 42.86
downstream ENSMUSE00000634267 Chr9:108465467..108465666 CATCCTCATGAGTGCCAATG Chr9:108465616..108465635 60.07 50
downstream ENSMUSE00000634266 Chr9:108465752..108465842 TGCCTCCAATGACCTGTAGA Chr9:108465842..108465861 59.24 50
downstream ENSMUSE00000529723 Chr9:108465927..108466022 CGACTCGCAAAGCATCTACA Chr9:108465989..108466008 60.16 50
downstream ENSMUSE00000465164 Chr9:108466966..108467109 GACGGGCATACTCAGAGACC Chr9:108467028..108467047 59.69 60
downstream ENSMUSE00000634264 Chr9:108467197..108467341 TTGTCCATGGCATCAAGAGA Chr9:108467314..108467333 60.2 45
downstream ENSMUSE00000634263 Chr9:108467433..108467576 TGGATAGACCCCTTGTCCTG Chr9:108467501..108467520 59.92 55
downstream ENSMUSE00000634262 Chr9:108467658..108467741 TTTAAGCTCCCCCGAGTACA Chr9:108467688..108467707 59.7 50
downstream ENSMUSE00000529708 Chr9:108467829..108467895 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCACTGCAGATCAGGTGGT Chr9:108463397..108463417 59.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACTGCAGATCAGGTGGT Chr9:108463397..108463417 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062867