Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24406
Trapped Gene
2210408I21Rik (ENSMUSG00000071252)
Vector Insertion
Chr 13: 77314246 - 77322861
Public Clones not available
Private Clones OST221922 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000612592 (Chr13:77314114..77314245 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTCCCGGAGATTTGGAGT Chr13:77314174..77314193 60.31 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000612592 (Chr13:77314114..77314245 +)
Downstram Exon
ENSMUSE00000612591 (Chr13:77322862..77323030 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTCCCGGAGATTTGGAGT Chr13:77314174..77314193 60.31 50 TGTGCATCTGGACAGAGCTT Chr13:77322924..77322943 59.58 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000119318 Chr13:77274860..77274891 No primer for this exon
upstream ENSMUSE00000612592 Chr13:77314114..77314245 GTTTCCCGGAGATTTGGAGT Chr13:77314174..77314193 60.31 50

*** Putative Vector Insertion (Chr 13: 77314246 - 77322861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000612591 Chr13:77322862..77323030 TGTGCATCTGGACAGAGCTT Chr13:77322924..77322943 59.58 50
downstream ENSMUSE00000570090 Chr13:77331815..77332484 TGCACGAAGGAAAGGAGTCT Chr13:77332211..77332230 59.99 50
downstream ENSMUSE00000612590 Chr13:77384462..77384623 AGAACTCCTGGGCATCTGAA Chr13:77384622..77384641 59.8 50
downstream ENSMUSE00000612589 Chr13:77393384..77393478 TGCCTCTGGTGGTTTATTGTT Chr13:77393462..77393482 59.49 42.86
downstream ENSMUSE00000612588 Chr13:77399102..77399329 ATGCAGTGTGCTATGGCAAG Chr13:77399172..77399191 59.9 50
downstream ENSMUSE00000612587 Chr13:77401150..77401415 CGCTGAGAGACATACGTTGC Chr13:77401376..77401395 59.62 55
downstream ENSMUSE00000612586 Chr13:77402793..77402943 GAATTCCTGATAGCGCTGGA Chr13:77402835..77402854 60.32 50
downstream ENSMUSE00000612585 Chr13:77406923..77407113 AGCTTAGGGGGCAGTATGGT Chr13:77407014..77407033 59.98 55
downstream ENSMUSE00000612584 Chr13:77409023..77409205 No primer for this exon
downstream ENSMUSE00000612583 Chr13:77420303..77420413 GTGATTCATCGACACCATGC Chr13:77420334..77420353 59.93 50
downstream ENSMUSE00000612582 Chr13:77437728..77437867 GGCTGCGATAAGAGCAGTTT Chr13:77437790..77437809 59.62 50
downstream ENSMUSE00000612579 Chr13:77442557..77442721 CAGGCTACCACCTGCACTCT Chr13:77442606..77442625 60.47 60
downstream ENSMUSE00000612544 Chr13:77455609..77455833 GTCCATCAGTGCCAGTCTCA Chr13:77455673..77455692 59.83 55
downstream ENSMUSE00000612543 Chr13:77462626..77463031 AAGCTGTTGCTCCATCCAGT Chr13:77463005..77463024 59.87 50
downstream ENSMUSE00000612542 Chr13:77467128..77467284 GGACCATCGCATTTGTTTTC Chr13:77467216..77467235 60.32 45
downstream ENSMUSE00000612541 Chr13:77471564..77471719 AGGCTGATCTTCATCCCTCA Chr13:77471665..77471684 59.76 50
downstream ENSMUSE00000612540 Chr13:77473530..77473638 ATTTGGCAGCAAGTTTGACC Chr13:77473580..77473599 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCCCTGTCCGAGAGAATG Chr13:77320226..77320246 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCTTCACACCGTGACTGG Chr13:77320286..77320306 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071252