Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24411
Trapped Gene
Rps15 (ENSMUSG00000063457)
Vector Insertion
Chr 10: 79756711 - 79756833
Public Clones not available
Private Clones OST221779 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000424321 (Chr10:79756712..79756857 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGATTCATCCCCCTCAAGTA Chr10:79756805..79756824 59.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000424321 (Chr10:79756712..79756857 +)
Downstram Exon
ENSMUSE00000665943 (Chr10:79756712..79756832 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGATTCATCCCCCTCAAGTA Chr10:79756805..79756824 59.89 50 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665948 Chr10:79755204..79755228 No primer for this exon
upstream ENSMUSE00000665944 Chr10:79755390..79755605 CTTCCGCAAGTTCACCTACC Chr10:79755549..79755568 59.73 55
upstream ENSMUSE00000665947 Chr10:79755520..79755605 CTTCCGCAAGTTCACCTACC Chr10:79755549..79755568 59.73 55
upstream ENSMUSE00000574856 Chr10:79756387..79756621 ACAACGGCAAGACCTTCAAC Chr10:79756587..79756606 60.16 50

*** Putative Vector Insertion (Chr 10: 79756711 - 79756833) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000424321 Chr10:79756712..79756857 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50
downstream ENSMUSE00000665943 Chr10:79756712..79756832 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50
downstream ENSMUSE00000665946 Chr10:79756712..79756720 No primer for this exon
downstream ENSMUSE00000665945 Chr10:79756784..79756825 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000063457