Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24414
Trapped Gene
Pfdn5 (ENSMUSG00000001289)
Vector Insertion
Chr 15: 102159028 - 102159142
Public Clones not available
Private Clones OST221766 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000133104 (Chr15:102158953..102159027 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000133104 (Chr15:102158953..102159027 +)
Downstram Exon
ENSMUSE00000133099 (Chr15:102159143..102159248 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368771 Chr15:102156610..102156691 No primer for this exon
upstream ENSMUSE00000133103 Chr15:102156864..102156966 No primer for this exon
upstream ENSMUSE00000133101 Chr15:102157249..102157280 No primer for this exon
upstream ENSMUSE00000133104 Chr15:102158953..102159027 No primer for this exon

*** Putative Vector Insertion (Chr 15: 102159028 - 102159142) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133099 Chr15:102159143..102159248 No primer for this exon
downstream ENSMUSE00000283367 Chr15:102161704..102161918 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGAAGTTCTGAGGAGGTG Chr15:102159047..102159067 61.02 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGAAGTTCTGAGGAGGTG Chr15:102159047..102159067 61.02 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001289