Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24420
Trapped Gene
Gm525 (ENSMUSG00000072553)
Vector Insertion
Chr 11: 88935320 - 88936302
Public Clones IST10057A2 (tigm)
Private Clones OST221463 (lexicon) OST33703 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648991 (Chr11:88935238..88935319 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCATCATGGAGAAGCTGTT Chr11:88935259..88935278 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648991 (Chr11:88935238..88935319 +)
Downstram Exon
ENSMUSE00000648990 (Chr11:88936303..88936403 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCATCATGGAGAAGCTGTT Chr11:88935259..88935278 60.23 50 GACCTCAGGAGCTGTTTTGC Chr11:88936354..88936373 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648991 Chr11:88935238..88935319 GGCATCATGGAGAAGCTGTT Chr11:88935259..88935278 60.23 50

*** Putative Vector Insertion (Chr 11: 88935320 - 88936302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648990 Chr11:88936303..88936403 GACCTCAGGAGCTGTTTTGC Chr11:88936354..88936373 60 55
downstream ENSMUSE00000648988 Chr11:88949870..88950005 CCAGGTCCTTCACACAGGAT Chr11:88949998..88950017 59.96 55
downstream ENSMUSE00000648986 Chr11:88954200..88954354 CTGGCGTTCTGCCTACACTT Chr11:88954256..88954275 60.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTAATCGCCTTGCAGCAC Chr11:88935368..88935388 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTTTGTCTTGGTCTTTGC Chr11:88935274..88935295 59.91 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072553