Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24430
Trapped Gene
Pou5f1 (ENSMUSG00000024406)
Vector Insertion
Chr 17: 35646484 - 35646925
Public Clones not available
Private Clones OST220878 (lexicon) OST196558 (lexicon) OST195987 (lexicon) OST100182 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142025 (Chr17:35646353..35646483 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCGACAACAATGAGAACC Chr17:35646456..35646475 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142025 (Chr17:35646353..35646483 +)
Downstram Exon
ENSMUSE00000142021 (Chr17:35646926..35647084 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCGACAACAATGAGAACC Chr17:35646456..35646475 60.12 50 TGATTGGCGATGTGAGTGAT Chr17:35647068..35647087 60.08 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000142023 Chr17:35643007..35643428 AGCACGAGTGGAAAGCAACT Chr17:35643329..35643348 60.06 50
upstream ENSMUSE00000142019 Chr17:35646048..35646168 GCAGAAGAGGATCACCTTGG Chr17:35646104..35646123 59.8 55
upstream ENSMUSE00000142025 Chr17:35646353..35646483 AGCCGACAACAATGAGAACC Chr17:35646456..35646475 60.12 50

*** Putative Vector Insertion (Chr 17: 35646484 - 35646925) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142021 Chr17:35646926..35647084 TGATTGGCGATGTGAGTGAT Chr17:35647068..35647087 60.08 45
downstream ENSMUSE00000394011 Chr17:35647233..35647714 TGGGAAAGGTGTCCCTGTAG Chr17:35647337..35647356 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTTCTGTAATCGCCTTG Chr17:35646526..35646546 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTCAGGAGGTGAGGAGTG Chr17:35646475..35646495 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024406