Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24433
Trapped Gene
6720456B07Rik (ENSMUSG00000033940)
Vector Insertion
Chr 6: 113565853 - 113566058
Public Clones not available
Private Clones OST220731 (lexicon) OST61472 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222782 (Chr6:113565770..113565852 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGTTCAAGACTCGCAACAC Chr6:113565780..113565799 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222782 (Chr6:113565770..113565852 +)
Downstram Exon
ENSMUSE00000373930 (Chr6:113566059..113566688 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGTTCAAGACTCGCAACAC Chr6:113565780..113565799 60.03 50 GGCGCACTTCTAGGTCAGAG Chr6:113566097..113566116 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000222791 Chr6:113554752..113554890 CGAACCGGGAGTACATTGAG Chr6:113554822..113554841 60.51 55
upstream ENSMUSE00000222782 Chr6:113565770..113565852 TCGTTCAAGACTCGCAACAC Chr6:113565780..113565799 60.03 50

*** Putative Vector Insertion (Chr 6: 113565853 - 113566058) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373930 Chr6:113566059..113566688 GGCGCACTTCTAGGTCAGAG Chr6:113566097..113566116 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTAATCGCCTTGCAGCAC Chr6:113565901..113565921 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACATTGAAGCGAGGGTGAGT Chr6:113565840..113565860 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033940