Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24435
Trapped Gene
Ubb (ENSMUSG00000019505)
Vector Insertion
Chr 11: 62365924 - 62366151
Public Clones not available
Private Clones OST220720 (lexicon) OST122853 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677684 (Chr11:62365642..62365923 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677684 (Chr11:62365642..62365923 +)
Downstram Exon
ENSMUSE00000677683 (Chr11:62366152..62366708 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677685 Chr11:62365006..62365097 No primer for this exon
upstream ENSMUSE00000335590 Chr11:62365642..62366714 No primer for this exon
upstream ENSMUSE00000677684 Chr11:62365642..62365923 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62365924 - 62366151) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677683 Chr11:62366152..62366708 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:62365975..62365995 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000019505