Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24467
Trapped Gene
Snrpd1 (ENSMUSG00000002477)
Vector Insertion
Chr 18: 10623706 - 10626823
Public Clones not available
Private Clones OST218988 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000289776 (Chr18:10623629..10623705 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000289776 (Chr18:10623629..10623705 +)
Downstram Exon
ENSMUSE00000140568 (Chr18:10626824..10627015 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000289791 Chr18:10617865..10617924 No primer for this exon
upstream ENSMUSE00000289776 Chr18:10623629..10623705 No primer for this exon

*** Putative Vector Insertion (Chr 18: 10623706 - 10626823) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000140568 Chr18:10626824..10627015 No primer for this exon
downstream ENSMUSE00000396618 Chr18:10627792..10627968 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGACATTTTTCCCCGTTG Chr18:10623662..10623682 60.7 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGACATTTTTCCCCGTTG Chr18:10623662..10623682 60.7 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002477