Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24477
Trapped Gene
Calcoco2 (ENSMUSG00000006056)
Vector Insertion
Chr 11: 95964875 - 95968744
Public Clones not available
Private Clones OST218511 (lexicon) OST210054 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000380218 (Chr11:95968745..95968918 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000380218 (Chr11:95968745..95968918 -)
Downstram Exon
ENSMUSE00000110945 (Chr11:95964772..95964874 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674120 Chr11:95973251..95973276 No primer for this exon
upstream ENSMUSE00000380218 Chr11:95968745..95968918 No primer for this exon

*** Putative Vector Insertion (Chr 11: 95964875 - 95968744) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110945 Chr11:95964772..95964874 No primer for this exon
downstream ENSMUSE00000110950 Chr11:95964531..95964664 No primer for this exon
downstream ENSMUSE00000110948 Chr11:95963962..95964066 No primer for this exon
downstream ENSMUSE00000110946 Chr11:95961648..95961716 No primer for this exon
downstream ENSMUSE00000674112 Chr11:95961581..95961646 No primer for this exon
downstream ENSMUSE00000674118 Chr11:95961561..95961716 No primer for this exon
downstream ENSMUSE00000390101 Chr11:95961228..95961716 No primer for this exon
downstream ENSMUSE00000674117 Chr11:95960640..95961266 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCCATAATCGCCTTGCAG Chr11:95968679..95968699 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCCACGTGACTGGGAAAA Chr11:95968679..95968699 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006056