Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24480
Trapped Gene
Zc3h6 (ENSMUSG00000042851)
Vector Insertion
Chr 2: 128819018 - 128819114
Public Clones not available
Private Clones OST218411 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000169100 (Chr2:128818895..128819017 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCCTGGACTCAGATGTTG Chr2:128818930..128818949 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000169100 (Chr2:128818895..128819017 +)
Downstram Exon
ENSMUSE00000683513 (Chr2:128819115..128819234 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCCTGGACTCAGATGTTG Chr2:128818930..128818949 59.42 55 GAACCACAGTGATGGCTGAA Chr2:128819139..128819158 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683516 Chr2:128793143..128793572 ATCTCTCTGGCGTTGGTTGT Chr2:128793324..128793343 59.73 50
upstream ENSMUSE00000314964 Chr2:128816827..128817007 CCAAAAGGAGGAAACACGAG Chr2:128816979..128816998 59.71 50
upstream ENSMUSE00000169100 Chr2:128818895..128819017 CAGCCTGGACTCAGATGTTG Chr2:128818930..128818949 59.42 55

*** Putative Vector Insertion (Chr 2: 128819018 - 128819114) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683513 Chr2:128819115..128819234 GAACCACAGTGATGGCTGAA Chr2:128819139..128819158 59.68 50
downstream ENSMUSE00000415838 Chr2:128823341..128823608 GAGAACGATGACCCTGAGGA Chr2:128823567..128823586 60.2 55
downstream ENSMUSE00000415835 Chr2:128827878..128828014 TTCTTCGGCAAAAGATGTCC Chr2:128827938..128827957 60.19 45
downstream ENSMUSE00000411756 Chr2:128831732..128831848 TCCACTTTTTCCCTGGTTTG Chr2:128831759..128831778 59.94 45
downstream ENSMUSE00000169083 Chr2:128832449..128832560 No primer for this exon
downstream ENSMUSE00000363510 Chr2:128836152..128836261 TTGGTAGCACTTTGCTCCACT Chr2:128836200..128836220 59.93 47.62
downstream ENSMUSE00000404496 Chr2:128837403..128837656 GAGTTATGCCGCGTTTCCTA Chr2:128837481..128837500 60.23 50
downstream ENSMUSE00000355717 Chr2:128840072..128840574 CCTCAAACTGTGGTCCTGGT Chr2:128840124..128840143 60 55
downstream ENSMUSE00000334899 Chr2:128841136..128841369 GTCAACGGGATGAAAAGAGC Chr2:128841304..128841323 59.68 50
downstream ENSMUSE00000683515 Chr2:128841858..128843320 AGTGGGGGCAGAGGTAAGTT Chr2:128842488..128842507 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACCAGCTCCTACAGGGATT Chr2:128818978..128818999 59.59 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACCAGCTCCTACAGGGATT Chr2:128818978..128818999 59.59 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042851