Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24492
Trapped Gene
Camk1d (ENSMUSG00000039145)
Vector Insertion
Chr 2: 5366191 - 5486694
Public Clones E002H02 (ggtc) E083B12 (ggtc)
Private Clones OST218118 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000402447 (Chr2:5486695..5486826 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGAGATTGCCGTGCTTAG Chr2:5486698..5486717 60.41 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000402447 (Chr2:5486695..5486826 -)
Downstram Exon
ENSMUSE00000570237 (Chr2:5366116..5366190 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGAGATTGCCGTGCTTAG Chr2:5486698..5486717 60.41 50 TGCATGACCAGGTAGAGGTG Chr2:5366097..5366116 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000570238 Chr2:5635192..5635808 CAAGGCGAAAGAGGAAACTG Chr2:5635437..5635456 59.99 50
upstream ENSMUSE00000647805 Chr2:5635192..5635283 CTCCTGGAAAAAGCAAGCAG Chr2:5635235..5635254 60.12 50
upstream ENSMUSE00000701339 Chr2:5596960..5597027 GGAGCTGGATAAAGGGTTCC Chr2:5596968..5596987 59.9 55
upstream ENSMUSE00000402447 Chr2:5486695..5486826 AACGAGATTGCCGTGCTTAG Chr2:5486698..5486717 60.41 50

*** Putative Vector Insertion (Chr 2: 5366191 - 5486694) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000570237 Chr2:5366116..5366190 TGCATGACCAGGTAGAGGTG Chr2:5366097..5366116 59.7 55
downstream ENSMUSE00000701332 Chr2:5283801..5283824 No primer for this exon
downstream ENSMUSE00000313360 Chr2:5283035..5283173 CCGATCGAAGAGTTCTCCAC Chr2:5283124..5283143 59.8 55
downstream ENSMUSE00000701331 Chr2:5283035..5283175 CCGATCGAAGAGTTCTCCAC Chr2:5283124..5283143 59.8 55
downstream ENSMUSE00000313356 Chr2:5275715..5275841 TCGACAAGCCAAAGTCACTG Chr2:5275750..5275769 60.03 50
downstream ENSMUSE00000430583 Chr2:5260228..5260303 GTTTCTGGGCGAGAACTTCC Chr2:5260258..5260277 61.13 55
downstream ENSMUSE00000570233 Chr2:5234135..5234247 CCCAGTAGGGGGAATCAAAC Chr2:5234131..5234150 60.55 55
downstream ENSMUSE00000570230 Chr2:5232038..5232116 TCCATCAGATTCCGAATGAAG Chr2:5232067..5232087 60.02 42.86
downstream ENSMUSE00000313338 Chr2:5224337..5224424 TGCAAAATTCTTCCGGATCT Chr2:5224330..5224349 59.65 40
downstream ENSMUSE00000647804 Chr2:5222585..5222659 AGCCTCCGCATATGTCTCAC Chr2:5222594..5222613 60.25 55
downstream ENSMUSE00000398917 Chr2:5222542..5222659 AGCCTCCGCATATGTCTCAC Chr2:5222594..5222613 60.25 55
downstream ENSMUSE00000647803 Chr2:5220055..5220147 TCTCCTCTCAGCTCCGACTC Chr2:5220052..5220071 59.82 60
downstream ENSMUSE00000701337 Chr2:5219686..5220147 GCTCCCCTTGAGTCAGTCAG Chr2:5219801..5219820 59.99 60
downstream ENSMUSE00000707233 Chr2:5219686..5220147 GCTCCCCTTGAGTCAGTCAG Chr2:5219801..5219820 59.99 60
downstream ENSMUSE00000430604 Chr2:5214510..5220147 GTCCACTCACGGTTGGTCTT Chr2:5217468..5217487 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCATAGCCCTGTGTAAGC Chr2:5405672..5405692 58.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCATAGCCCTGTGTAAGC Chr2:5405672..5405692 58.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCGTCGGGATCCAAGTAATC Chr2:5405771..5405791 59.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTCGTGACTGGGAAAACC Chr2:5405760..5405780 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039145