Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24495
Trapped Gene
Pml (ENSMUSG00000036986)
Vector Insertion
Chr 9: 58081055 - 58082159
Public Clones not available
Private Clones OST218039 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254901 (Chr9:58082160..58082740 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCATCTCCATTGCGATATT Chr9:58082656..58082675 59.89 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254901 (Chr9:58082160..58082740 -)
Downstram Exon
ENSMUSE00000254882 (Chr9:58080960..58081054 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCATCTCCATTGCGATATT Chr9:58082656..58082675 59.89 45 TGGTTGTCACTGGGTGAGTG Chr9:58080961..58080980 60.63 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485399 Chr9:58097348..58097593 TGTCGACAACAGGACTCTGC Chr9:58097424..58097443 60.03 55
upstream ENSMUSE00000254921 Chr9:58094782..58095245 CAGTACGCGCAAGTCCAATA Chr9:58094825..58094844 59.9 50
upstream ENSMUSE00000254901 Chr9:58082160..58082740 GCCATCTCCATTGCGATATT Chr9:58082656..58082675 59.89 45

*** Putative Vector Insertion (Chr 9: 58081055 - 58082159) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254882 Chr9:58080960..58081054 TGGTTGTCACTGGGTGAGTG Chr9:58080961..58080980 60.63 55
downstream ENSMUSE00000457341 Chr9:58078298..58078435 CATAGCCACAGGTTGGGTCT Chr9:58078348..58078367 59.99 55
downstream ENSMUSE00000254861 Chr9:58077635..58077893 GTCCTCGTTCTCCTCTGTGG Chr9:58077773..58077792 59.83 60
downstream ENSMUSE00000254833 Chr9:58077162..58077214 CAGATTCTCGGTGTCCGAAT Chr9:58077140..58077159 60.07 50
downstream ENSMUSE00000254804 Chr9:58069522..58069672 GCTGCTATCGTCCAACTCGT Chr9:58069624..58069643 60.43 55
downstream ENSMUSE00000534036 Chr9:58066349..58068376 TCAGTGTGTGGAAACGGGTA Chr9:58067039..58067058 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTCCTGCATCACCCAGAG Chr9:58082163..58082183 60.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGACTTCATCTCCTGCATCA Chr9:58082170..58082191 59.82 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036986