Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24509
Trapped Gene
Crls1 (ENSMUSG00000027357)
Vector Insertion
Chr 2: 132673617 - 132675601
Public Clones not available
Private Clones OST217089 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682843 (Chr2:132673470..132673616 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGAAGTTGCCCTCAACC Chr2:132673565..132673584 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682843 (Chr2:132673470..132673616 +)
Downstram Exon
ENSMUSE00000682842 (Chr2:132675602..132675739 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGAAGTTGCCCTCAACC Chr2:132673565..132673584 59.71 50 TTGGGATTGTCCATGGATTT Chr2:132675629..132675648 59.99 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000168704 Chr2:132672424..132672861 GCGTCTGAGTTCTCGACTCTT Chr2:132672508..132672528 58.83 52.38
upstream ENSMUSE00000682843 Chr2:132673470..132673616 CTTTGAAGTTGCCCTCAACC Chr2:132673565..132673584 59.71 50

*** Putative Vector Insertion (Chr 2: 132673617 - 132675601) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000596070 Chr2:132675602..132675739 TTGGGATTGTCCATGGATTT Chr2:132675629..132675648 59.99 40
downstream ENSMUSE00000682842 Chr2:132675602..132675739 TTGGGATTGTCCATGGATTT Chr2:132675629..132675648 59.99 40
downstream ENSMUSE00000168701 Chr2:132680629..132680758 GCCCAGTTTCGAGCAATAAA Chr2:132680660..132680679 60.21 45
downstream ENSMUSE00000596069 Chr2:132686945..132687030 TGGCAGAGTTCGGTATCTGA Chr2:132687027..132687046 59.39 50
downstream ENSMUSE00000596068 Chr2:132688071..132688139 TGGCATAGCAAGGATTGAAG Chr2:132688110..132688129 58.87 45
downstream ENSMUSE00000596067 Chr2:132689826..132689917 GAAAACTGGAGCTGCCAAAG Chr2:132689885..132689904 59.99 50
downstream ENSMUSE00000168700 Chr2:132691573..132692502 TGATGTCATGCTTTGCCTGT Chr2:132692344..132692363 60.27 45
downstream ENSMUSE00000706218 Chr2:132691573..132692521 TGATGTCATGCTTTGCCTGT Chr2:132692344..132692363 60.27 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCTTTGTCGACCGTGACT Chr2:132673655..132673675 59.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027357