Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24512
Trapped Gene
2010100O12Rik (ENSMUSG00000067847)
Vector Insertion
Chr 2: 155970194 - 155970326
Public Clones not available
Private Clones OST216978 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000553461 (Chr2:155970195..155970325 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCACCTTCTCCTGTCTCAG Chr2:155970306..155970325 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000553461 (Chr2:155970195..155970325 +)
Downstram Exon
ENSMUSE00000712760 (Chr2:155970195..155970325 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCACCTTCTCCTGTCTCAG Chr2:155970306..155970325 59.99 60 GACAGGAGAAGGTGCCGAAC Chr2:155970324..155970343 62.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680878 Chr2:155969969..155970325 ATTCGGAGTGAGACGTCGAG Chr2:155969972..155969991 60.41 55
upstream ENSMUSE00000680877 Chr2:155969973..155970021 GAGTGAGACGTCGAGCTGAG Chr2:155969977..155969996 58.86 60
upstream ENSMUSE00000712669 Chr2:155969976..155970016 GAGTGAGACGTCGAGCTGAG Chr2:155969977..155969996 58.86 60
upstream ENSMUSE00000680881 Chr2:155969980..155970016 No primer for this exon
upstream ENSMUSE00000719558 Chr2:155970181..155970325 GGCACCTTCTCCTGTCTCAG Chr2:155970306..155970325 59.99 60

*** Putative Vector Insertion (Chr 2: 155970194 - 155970326) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000553461 Chr2:155970195..155970325 GACAGGAGAAGGTGCCGAAC Chr2:155970324..155970343 62.16 60
downstream ENSMUSE00000712760 Chr2:155970195..155970325 GACAGGAGAAGGTGCCGAAC Chr2:155970324..155970343 62.16 60
downstream ENSMUSE00000553460 Chr2:155971338..155971519 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50
downstream ENSMUSE00000680879 Chr2:155971338..155971529 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50
downstream ENSMUSE00000706115 Chr2:155971338..155971530 TTAGGTATTGCAGGGCATCC Chr2:155971478..155971497 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCCAGCTGCTTCGTAATC Chr2:155970230..155970250 61.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTCACTGTCCTAGCACTC Chr2:155970166..155970187 61.37 61.9 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067847