Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24522
Trapped Gene
EG245174 (ENSMUSG00000079009)
Vector Insertion
Chr 2: 150016516 - 150017591
Public Clones not available
Private Clones OST216711 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682136 (Chr2:150016455..150016515 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGAAGACCATAATACGGAAG Chr2:150016463..150016484 60.2 45.46 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682136 (Chr2:150016455..150016515 +)
Downstram Exon
ENSMUSE00000682135 (Chr2:150017592..150018888 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGAAGACCATAATACGGAAG Chr2:150016463..150016484 60.2 45.46 TCCACTTGGAGACGAAAAGG Chr2:150018594..150018613 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682134 Chr2:150007491..150007606 ATCTGAGCCGGAAAGAAGGT Chr2:150007511..150007530 60.21 50
upstream ENSMUSE00000682132 Chr2:150016129..150016255 CCTACAGGAATCTCGCTGCT Chr2:150016232..150016251 59.6 55
upstream ENSMUSE00000682137 Chr2:150016222..150016255 CCTACAGGAATCTCGCTGCT Chr2:150016232..150016251 59.6 55
upstream ENSMUSE00000682136 Chr2:150016455..150016515 TGGGAAGACCATAATACGGAAG Chr2:150016463..150016484 60.2 45.46

*** Putative Vector Insertion (Chr 2: 150016516 - 150017591) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000682131 Chr2:150017592..150019015 TCCACTTGGAGACGAAAAGG Chr2:150018594..150018613 60.22 50
downstream ENSMUSE00000682135 Chr2:150017592..150018888 TCCACTTGGAGACGAAAAGG Chr2:150018594..150018613 60.22 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000079009