Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24523
Trapped Gene
Ndufb3 (ENSMUSG00000026032)
Vector Insertion
Chr 1: 58648094 - 58652492
Public Clones CMHD-GT_456H3-3 (cmhd) CMHD-GT_381C1-3 (cmhd)
Private Clones OST216677 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000155114 (Chr1:58647934..58648093 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGGGACGCCATTAGAAA Chr1:58648025..58648044 60.58 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000155114 (Chr1:58647934..58648093 +)
Downstram Exon
ENSMUSE00000343428 (Chr1:58652493..58652792 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGGGACGCCATTAGAAA Chr1:58648025..58648044 60.58 45 ATCACCATTCTGGGAATCCA Chr1:58652637..58652656 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337266 Chr1:58643443..58643514 GTCTCCGGCTGTAAGGTTGA Chr1:58643460..58643479 60.26 55
upstream ENSMUSE00000155114 Chr1:58647934..58648093 TGAAGGGACGCCATTAGAAA Chr1:58648025..58648044 60.58 45

*** Putative Vector Insertion (Chr 1: 58648094 - 58652492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000343428 Chr1:58652493..58652792 ATCACCATTCTGGGAATCCA Chr1:58652637..58652656 60.13 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGATCTTAATCGCCTTGCAG Chr1:58651139..58651159 60.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGATCTCGTGACTGGGAAA Chr1:58651138..58651158 63.48 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026032