Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24525
Trapped Gene
Qsox2 (ENSMUSG00000036327)
Vector Insertion
Chr 2: 26083968 - 26092562
Public Clones not available
Private Clones OST216625 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000340020 (Chr2:26092563..26092908 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTTCCACTCGTCGTGGTG Chr2:26092619..26092638 62.79 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000340020 (Chr2:26092563..26092908 -)
Downstram Exon
ENSMUSE00000646742 (Chr2:26083867..26083967 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTTCCACTCGTCGTGGTG Chr2:26092619..26092638 62.79 60 ACAGTCCAGAGCAGCAACAC Chr2:26083908..26083927 59.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340020 Chr2:26092563..26092908 CAGTTCCACTCGTCGTGGTG Chr2:26092619..26092638 62.79 60

*** Putative Vector Insertion (Chr 2: 26083968 - 26092562) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000646742 Chr2:26083867..26083967 ACAGTCCAGAGCAGCAACAC Chr2:26083908..26083927 59.05 55
downstream ENSMUSE00000646740 Chr2:26081758..26081806 CTCCCGTTGTAAACTCCTTTG Chr2:26081748..26081768 58.75 47.62
downstream ENSMUSE00000646739 Chr2:26080669..26080774 CAGGTGCCCTCAGTATGGTT Chr2:26080680..26080699 59.99 55
downstream ENSMUSE00000698302 Chr2:26080669..26080891 GTCGATCATTGTCTGCCTGA Chr2:26080709..26080728 59.79 50
downstream ENSMUSE00000236376 Chr2:26080361..26080451 TGTGGCTATCCATGAAGGAA Chr2:26080395..26080414 59.08 45
downstream ENSMUSE00000236370 Chr2:26077741..26077886 CAAGTGTCCCCAGAAATGCT Chr2:26077783..26077802 60.11 50
downstream ENSMUSE00000662987 Chr2:26076429..26076563 CCAAACCACCACCTCTGATT Chr2:26076421..26076440 59.82 50
downstream ENSMUSE00000662986 Chr2:26076150..26076279 GCAACGACAGTCACGAAGTC Chr2:26076132..26076151 59.47 55
downstream ENSMUSE00000236343 Chr2:26074129..26074251 TCCTGCAGTGTCTCCAACAG Chr2:26074180..26074199 60.02 55
downstream ENSMUSE00000236334 Chr2:26073153..26073303 TCCAATCGACTTCCTTGACA Chr2:26073220..26073239 59.22 45
downstream ENSMUSE00000236323 Chr2:26069501..26069689 CGGCTGTTTACCATGTTGTG Chr2:26069487..26069506 60.03 50
downstream ENSMUSE00000236313 Chr2:26066794..26066979 GAGTATGCGTCCACCAGGTT Chr2:26066792..26066811 60 55
downstream ENSMUSE00000431370 Chr2:26065111..26065313 AGGTTCACGTGGCTGAGTCT Chr2:26065231..26065250 59.91 55
downstream ENSMUSE00000706984 Chr2:26064651..26066979 GAGTATGCGTCCACCAGGTT Chr2:26066792..26066811 60 55
downstream ENSMUSE00000569055 Chr2:26064645..26066979 GAGTATGCGTCCACCAGGTT Chr2:26066792..26066811 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:26086492..26086512 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACGTGCGTGACTGGGAAA Chr2:26086498..26086518 62.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036327