Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24534
Trapped Gene
Mkl2 (ENSMUSG00000079844)
Vector Insertion
Chr 16: 13265233 - 13326474
Public Clones IST10060F5 (tigm) IST14162D2 (tigm)
Private Clones OST216250 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704247 (Chr16:13265169..13265232 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704247 (Chr16:13265169..13265232 +)
Downstram Exon
ENSMUSE00000395817 (Chr16:13326475..13326664 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGAGGACTTGGTGCAAGATG Chr16:13326584..13326603 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704246 Chr16:13256599..13256647 No primer for this exon
upstream ENSMUSE00000704247 Chr16:13265169..13265232 No primer for this exon
upstream ENSMUSE00000704249 Chr16:13265172..13265232 No primer for this exon

*** Putative Vector Insertion (Chr 16: 13265233 - 13326474) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000395817 Chr16:13326475..13326664 TGAGGACTTGGTGCAAGATG Chr16:13326584..13326603 59.83 50
downstream ENSMUSE00000719134 Chr16:13326475..13326664 TGAGGACTTGGTGCAAGATG Chr16:13326584..13326603 59.83 50
downstream ENSMUSE00000365237 Chr16:13332107..13332169 AGTCCTGACTCCCCAAAGACT Chr16:13332136..13332156 59.21 52.38
downstream ENSMUSE00000408575 Chr16:13332712..13333012 AGGAGGCGTCTATTCCAGGT Chr16:13332870..13332889 60.1 55
downstream ENSMUSE00000704245 Chr16:13332712..13333015 AGGAGGCGTCTATTCCAGGT Chr16:13332870..13332889 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCTAGAGGCAATGAGGA Chr16:13322235..13322255 60.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGCTAGAGGCAATGAGGA Chr16:13322235..13322255 60.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079844