Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24535
Trapped Gene
Dalrd3 (ENSMUSG00000019039)
Vector Insertion
Chr 9: 108472777 - 108472894
Public Clones not available
Private Clones OST216225 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221392 (Chr9:108472481..108472776 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221392 (Chr9:108472481..108472776 +)
Downstram Exon
ENSMUSE00000221383 (Chr9:108472895..108473145 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221386 Chr9:108472242..108472406 No primer for this exon
upstream ENSMUSE00000221392 Chr9:108472481..108472776 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108472777 - 108472894) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221383 Chr9:108472895..108473145 No primer for this exon
downstream ENSMUSE00000377565 Chr9:108473223..108473302 No primer for this exon
downstream ENSMUSE00000347312 Chr9:108473376..108473504 No primer for this exon
downstream ENSMUSE00000221381 Chr9:108473777..108473850 No primer for this exon
downstream ENSMUSE00000221384 Chr9:108473944..108474005 No primer for this exon
downstream ENSMUSE00000221388 Chr9:108474113..108474195 No primer for this exon
downstream ENSMUSE00000221390 Chr9:108474272..108474448 No primer for this exon
downstream ENSMUSE00000221391 Chr9:108474518..108474628 No primer for this exon
downstream ENSMUSE00000350054 Chr9:108474724..108474792 No primer for this exon
downstream ENSMUSE00000490416 Chr9:108474882..108475103 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTACGGGTACTGCGTGCTC Chr9:108472754..108472774 60.34 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTACGGGTACTGCGTGCTC Chr9:108472754..108472774 60.34 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019039