Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24549
Trapped Gene
Utp15 (ENSMUSG00000041747)
Vector Insertion
Chr 13: 99019332 - 99020526
Public Clones not available
Private Clones OST215789 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000296309 (Chr13:99020527..99020585 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGTCTCAGCCGAGGTTC Chr13:99020564..99020583 59.41 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000296309 (Chr13:99020527..99020585 -)
Downstram Exon
ENSMUSE00000480312 (Chr13:99016800..99019331 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGTCTCAGCCGAGGTTC Chr13:99020564..99020583 59.41 55 GAAGTGACCAGCGAGAGGAC Chr13:99018627..99018646 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434212 Chr13:99032830..99032947 TGCAGAGCGGTATGCTGTAG Chr13:99032899..99032918 60.18 55
upstream ENSMUSE00000434206 Chr13:99030754..99030925 TGGCCGGCTATAAACCTGTA Chr13:99030823..99030842 60.47 50
upstream ENSMUSE00000434193 Chr13:99029329..99029421 ATGCAGTCACAGCTTCTTCG Chr13:99029332..99029351 59.19 50
upstream ENSMUSE00000434187 Chr13:99029060..99029244 CGACTTTTCGACAGGATGGT Chr13:99029152..99029171 60.11 50
upstream ENSMUSE00000339862 Chr13:99027791..99027969 TGTGGTCTCTGGAGCTGATG Chr13:99027911..99027930 59.98 55
upstream ENSMUSE00000380856 Chr13:99027056..99027181 CAGCCAGTGGAGAGTGTCCT Chr13:99027091..99027110 60.46 60
upstream ENSMUSE00000337545 Chr13:99024874..99025009 GTTACTCTCCGGCTCACTGG Chr13:99024878..99024897 59.87 60
upstream ENSMUSE00000296346 Chr13:99023599..99023683 CGTCCACAGCTTTGACTACG Chr13:99023628..99023647 59.51 55
upstream ENSMUSE00000296336 Chr13:99022700..99022849 ACACCGGAAGTCTGAAGCAA Chr13:99022777..99022796 60.83 50
upstream ENSMUSE00000296326 Chr13:99021884..99021985 AAAAGCTTTCGGGTCTCACA Chr13:99021906..99021925 59.85 45
upstream ENSMUSE00000296319 Chr13:99020740..99020873 CCCGGGTCCTTAACTTTTTG Chr13:99020745..99020764 60.68 50
upstream ENSMUSE00000296309 Chr13:99020527..99020585 ATCTGTCTCAGCCGAGGTTC Chr13:99020564..99020583 59.41 55

*** Putative Vector Insertion (Chr 13: 99019332 - 99020526) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480312 Chr13:99016800..99019331 GAAGTGACCAGCGAGAGGAC Chr13:99018627..99018646 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr13:99020456..99020476 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGGACGTGACTGGGAAAA Chr13:99020461..99020481 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041747