Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2455
Trapped Gene
CT030170.10 (ENSMUSG00000079167)
Vector Insertion
Chr 12: 17889129 - 17907465
Public Clones AA0330 (sanger) (sanger) 5SE079E12 (ggtc) E066H03 (ggtc) 3SE079E12 (ggtc)
5SE142C06 (ggtc) (ggtc)
Private Clones OST376811 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655829 (Chr12:17888720..17889128 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655829 (Chr12:17888720..17889128 +)
Downstram Exon
ENSMUSE00000655875 (Chr12:17907466..17907592 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAAGGATCCAGCAAATTCCA Chr12:17907536..17907555 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655829 Chr12:17888720..17889128 No primer for this exon

*** Putative Vector Insertion (Chr 12: 17889129 - 17907465) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655875 Chr12:17907466..17907592 GAAGGATCCAGCAAATTCCA Chr12:17907536..17907555 60.01 45
downstream ENSMUSE00000686286 Chr12:17907793..17907853 No primer for this exon
downstream ENSMUSE00000686285 Chr12:17940179..17940562 GGAAGCCCTTCTACCACTCC Chr12:17940293..17940312 60.07 60
downstream ENSMUSE00000686284 Chr12:17941954..17942059 ATCACGGAGGACACCATCTT Chr12:17941985..17942004 59.38 50
downstream ENSMUSE00000466441 Chr12:17945595..17946436 ATGCCAAGTCAATGGAAAGG Chr12:17946418..17946437 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTAATCGCCTTGCAGCAC Chr12:17889177..17889197 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTCGTGACTGGGAAAACC Chr12:17898176..17898196 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079167