Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24552
Trapped Gene
Kcnn3 (ENSMUSG00000000794)
Vector Insertion
Chr 3: 89465171 - 89466635
Public Clones not available
Private Clones OST215554 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000358705 (Chr3:89465043..89465170 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000358705 (Chr3:89465043..89465170 +)
Downstram Exon
ENSMUSE00000399381 (Chr3:89466636..89466705 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000494735 Chr3:89324086..89325326 No primer for this exon
upstream ENSMUSE00000174614 Chr3:89368781..89368876 No primer for this exon
upstream ENSMUSE00000398262 Chr3:89413240..89413658 No primer for this exon
upstream ENSMUSE00000462467 Chr3:89449364..89449505 No primer for this exon
upstream ENSMUSE00000518569 Chr3:89455940..89456050 No primer for this exon
upstream ENSMUSE00000358705 Chr3:89465043..89465170 No primer for this exon

*** Putative Vector Insertion (Chr 3: 89465171 - 89466635) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399381 Chr3:89466636..89466705 No primer for this exon
downstream ENSMUSE00000389591 Chr3:89471007..89471326 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCGGAGAACCAGAGCAGTG Chr3:89465178..89465198 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCGGAGAACCAGAGCAGTG Chr3:89465178..89465198 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000794