Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24558
Trapped Gene
Usp6nl (ENSMUSG00000039046)
Vector Insertion
Chr 2: 6244001 - 6257413
Public Clones not available
Private Clones OST215329 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701195 (Chr2:6243803..6244000 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCCTGGAAGGGAAACAAT Chr2:6243884..6243903 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701195 (Chr2:6243803..6244000 +)
Downstram Exon
ENSMUSE00000605430 (Chr2:6257414..6257505 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCCTGGAAGGGAAACAAT Chr2:6243884..6243903 60.3 50 GGGTGTTGTTCCAATCCAGT Chr2:6257488..6257507 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701187 Chr2:6243713..6244000 CCTCCTGGAAGGGAAACAAT Chr2:6243884..6243903 60.3 50
upstream ENSMUSE00000701195 Chr2:6243803..6244000 CCTCCTGGAAGGGAAACAAT Chr2:6243884..6243903 60.3 50

*** Putative Vector Insertion (Chr 2: 6244001 - 6257413) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605430 Chr2:6257414..6257505 GGGTGTTGTTCCAATCCAGT Chr2:6257488..6257507 59.68 50
downstream ENSMUSE00000712373 Chr2:6257414..6257505 GGGTGTTGTTCCAATCCAGT Chr2:6257488..6257507 59.68 50
downstream ENSMUSE00000430099 Chr2:6273782..6273910 TGCTAGTTAGCAAGCCAGAGG Chr2:6273839..6273859 59.8 52.38
downstream ENSMUSE00000311852 Chr2:6312101..6312168 TTTCAGCTCGTTCTTGAGCA Chr2:6312151..6312170 59.86 45
downstream ENSMUSE00000311845 Chr2:6315519..6315601 AAAAAGCCAAATCTATCGGTGA Chr2:6315599..6315620 59.97 36.36
downstream ENSMUSE00000311835 Chr2:6321326..6321365 CGCAGCTGCATTATGGTATG Chr2:6321362..6321381 60.26 50
downstream ENSMUSE00000311826 Chr2:6329975..6330055 TCCTTTCGATTTCCAGTTGC Chr2:6330002..6330021 60.19 45
downstream ENSMUSE00000311818 Chr2:6335979..6336086 AAGAAGAGCCCAGACTTCACC Chr2:6336043..6336063 59.87 52.38
downstream ENSMUSE00000311807 Chr2:6341949..6342058 CGGTTCACGTCAAGGTCTATT Chr2:6342015..6342035 59.11 47.62
downstream ENSMUSE00000311797 Chr2:6344468..6344516 TAAGCAGCGAGAACATGGAA Chr2:6344503..6344522 59.57 45
downstream ENSMUSE00000311789 Chr2:6345318..6345438 CTGACTCATCCCTTGGCAGT Chr2:6345350..6345369 60.26 55
downstream ENSMUSE00000311781 Chr2:6347941..6348035 No primer for this exon
downstream ENSMUSE00000311769 Chr2:6348598..6348663 No primer for this exon
downstream ENSMUSE00000311761 Chr2:6348758..6348857 CCCATATCCTGAGGTTCAGC Chr2:6348791..6348810 59.51 55
downstream ENSMUSE00000311752 Chr2:6351472..6351624 CTTTGCCCGCTTTAGTTCTG Chr2:6351608..6351627 60.01 50
downstream ENSMUSE00000430092 Chr2:6361407..6367436 AAGACCGAGTGCCAGAGAAA Chr2:6363655..6363674 59.99 50
downstream ENSMUSE00000570152 Chr2:6361407..6364866 AAGGTGATGCGGTTCAAAAC Chr2:6364705..6364724 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACATTTCCTGCCTTTTCC Chr2:6255965..6255985 60.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACATTTCCTGCCTTTTCC Chr2:6255965..6255985 60.05 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039046