Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24559
Trapped Gene
Abcc1 (ENSMUSG00000023088)
Vector Insertion
Chr 16: 14361737 - 14389899
Public Clones IST10948B10 (tigm) IST14591F8 (tigm)
Private Clones OST215303 (lexicon) OST193597 (lexicon) OST39962 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645724 (Chr16:14361653..14361736 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645724 (Chr16:14361653..14361736 +)
Downstram Exon
ENSMUSE00000260275 (Chr16:14389900..14390076 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGGACCGTGTTCTGAAAGC Chr16:14389968..14389987 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000645724 Chr16:14361653..14361736 No primer for this exon

*** Putative Vector Insertion (Chr 16: 14361737 - 14389899) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260275 Chr16:14389900..14390076 GAGGACCGTGTTCTGAAAGC Chr16:14389968..14389987 59.85 55
downstream ENSMUSE00000260262 Chr16:14391411..14391536 TGTTGGGCTGACCAGTAACA Chr16:14391521..14391540 60.15 50
downstream ENSMUSE00000260255 Chr16:14394046..14394183 AATTCCCGAGGATTGGACTC Chr16:14394108..14394127 60.27 50
downstream ENSMUSE00000260249 Chr16:14396444..14396569 AGGGGTGAGCAGTCTGAGAA Chr16:14396547..14396566 59.99 55
downstream ENSMUSE00000260236 Chr16:14404083..14404144 GAAAGGAAAGAGGCACTGGA Chr16:14404120..14404139 59.4 50
downstream ENSMUSE00000260226 Chr16:14405107..14405238 TTCACCAGCACAGGTACCAC Chr16:14405208..14405227 59.6 55
downstream ENSMUSE00000260218 Chr16:14410793..14411026 CTTGACAATCAGTGCCTCCA Chr16:14410898..14410917 59.83 50
downstream ENSMUSE00000260208 Chr16:14411542..14411719 TGCCACTGACGAAGCAGATA Chr16:14411681..14411700 60.56 50
downstream ENSMUSE00000563069 Chr16:14413314..14413475 GGGCTAGGATGACTTGCAGA Chr16:14413461..14413480 60.36 55
downstream ENSMUSE00000563068 Chr16:14419793..14419885 GGCCATCACAGCATTTAAGG Chr16:14419867..14419886 60.47 50
downstream ENSMUSE00000260186 Chr16:14423150..14423353 TCCCATTGAGGATCTCGTTC Chr16:14423213..14423232 60.01 50
downstream ENSMUSE00000260177 Chr16:14436600..14436746 GGGAAGCGCAAGATATTGAA Chr16:14436709..14436728 60.17 45
downstream ENSMUSE00000260170 Chr16:14437739..14437826 GAAAAATCCTGAGACGCTTGA Chr16:14437774..14437794 59.44 42.86
downstream ENSMUSE00000260163 Chr16:14440080..14440152 CCCAAGTGAAGGTTGCATTC Chr16:14440127..14440146 60.49 50
downstream ENSMUSE00000260157 Chr16:14443441..14443567 ACATGTCCCTCCACCTTGTC Chr16:14443560..14443579 59.82 55
downstream ENSMUSE00000260152 Chr16:14445386..14445562 GGCTTCCATAACTGCCTTGT Chr16:14445502..14445521 59.2 50
downstream ENSMUSE00000260145 Chr16:14447571..14447738 GGACCAACCACCTTCTCAAA Chr16:14447719..14447738 59.94 50
downstream ENSMUSE00000260138 Chr16:14448493..14448676 ATAGGTGCGCAGGAACTCAG Chr16:14448642..14448661 60.42 55
downstream ENSMUSE00000260134 Chr16:14457981..14458062 CAGGTGCTTTCCTACGGTGT Chr16:14458060..14458079 60.17 55
downstream ENSMUSE00000260127 Chr16:14459090..14459222 CCACTGTGGGAAGACGAGTT Chr16:14459122..14459141 60.15 55
downstream ENSMUSE00000133456 Chr16:14459850..14460060 TCAGCCGAAAATTCCTGTTC Chr16:14460033..14460052 60.19 45
downstream ENSMUSE00000260114 Chr16:14460991..14461301 CAGCCATGGAGTAGCCAAAT Chr16:14461023..14461042 60.1 50
downstream ENSMUSE00000133450 Chr16:14465136..14465335 GATGACACTGACTCCCAGCA Chr16:14465243..14465262 59.83 55
downstream ENSMUSE00000133448 Chr16:14466197..14466323 GGGAGATGACTGCAAAGAGG Chr16:14466273..14466292 59.8 55
downstream ENSMUSE00000133455 Chr16:14467090..14467191 CTCCATCTCCGAGGACATTC Chr16:14467140..14467159 59.61 55
downstream ENSMUSE00000133447 Chr16:14467916..14468062 ACTCTACACGGCCTGAATGG Chr16:14467982..14468001 60.13 55
downstream ENSMUSE00000133446 Chr16:14470563..14470721 AGCTCCCGTACGACCTACAA Chr16:14470592..14470611 59.76 55
downstream ENSMUSE00000133445 Chr16:14472031..14472197 TCATGGTTCAGCTTGTCAGG Chr16:14472173..14472192 59.83 50
downstream ENSMUSE00000338719 Chr16:14472904..14473098 ATGGTGTTAAGCCGATGAGC Chr16:14473086..14473105 60.1 50
downstream ENSMUSE00000645703 Chr16:14473553..14474965 AGGGGCAAGGTGTAAGTCCT Chr16:14474363..14474382 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAAATGTAATCGCCTTG Chr16:14364779..14364799 60.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTATTGGACCAGCCCGTGA Chr16:14364773..14364793 63.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023088