Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24570
Trapped Gene
Egfl7 (ENSMUSG00000026921)
Vector Insertion
Chr 2: 26444967 - 26445899
Public Clones not available
Private Clones OST214689 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164259 (Chr2:26444850..26444966 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATTTCCGGAGGTTCCATCT Chr2:26444871..26444890 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164259 (Chr2:26444850..26444966 +)
Downstram Exon
ENSMUSE00000164264 (Chr2:26445900..26446015 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATTTCCGGAGGTTCCATCT Chr2:26444871..26444890 60.27 50 TAGGCAGTCCGGTAGATGGT Chr2:26445923..26445942 59.57 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662972 Chr2:26436576..26436761 CTGTTCGAGATGCCCATGTA Chr2:26436609..26436628 59.67 50
upstream ENSMUSE00000662970 Chr2:26439389..26439568 No primer for this exon
upstream ENSMUSE00000479571 Chr2:26441105..26441195 ACCAGTACCCAGGGGATGAC Chr2:26441159..26441178 61.03 60
upstream ENSMUSE00000482074 Chr2:26444565..26444689 GCTCCGGAGAACTGCTTGTA Chr2:26444614..26444633 60.54 55
upstream ENSMUSE00000713459 Chr2:26444565..26444689 GCTCCGGAGAACTGCTTGTA Chr2:26444614..26444633 60.54 55
upstream ENSMUSE00000164259 Chr2:26444850..26444966 GATTTCCGGAGGTTCCATCT Chr2:26444871..26444890 60.27 50

*** Putative Vector Insertion (Chr 2: 26444967 - 26445899) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164264 Chr2:26445900..26446015 TAGGCAGTCCGGTAGATGGT Chr2:26445923..26445942 59.57 55
downstream ENSMUSE00000164260 Chr2:26446177..26446272 GCAAGTATCTCCCTGCCATC Chr2:26446268..26446287 59.66 55
downstream ENSMUSE00000164265 Chr2:26446419..26446583 TCCCTGGCACCAGTAACTTC Chr2:26446501..26446520 60.11 55
downstream ENSMUSE00000164261 Chr2:26447184..26447248 CTGCAGCCTGTACACCTCCT Chr2:26447227..26447246 60.47 60
downstream ENSMUSE00000482935 Chr2:26447638..26447800 GGATCTTGTAGCCCATGCTC Chr2:26447711..26447730 59.66 55
downstream ENSMUSE00000646586 Chr2:26447638..26447761 CAGGATCTTGTAGCCCATGC Chr2:26447713..26447732 60.62 55
downstream ENSMUSE00000477526 Chr2:26447938..26448202 CTCATAGGCACCACCAGACA Chr2:26448051..26448070 59.7 55
downstream ENSMUSE00000697969 Chr2:26447938..26448201 CTCATAGGCACCACCAGACA Chr2:26448051..26448070 59.7 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCTTACCTCACCACTTGC Chr2:26444919..26444939 59.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTTACCTCACCACTTGC Chr2:26444919..26444939 59.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026921