Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24601
Trapped Gene
St3gal2 (ENSMUSG00000031749)
Vector Insertion
Chr 8: 113444006 - 113480657
Public Clones IST14100E5 (tigm) IST14937F11 (tigm) IST14614H7 (tigm) IST14950D4 (tigm)
IST14465C11 (tigm) IST14100E5 (tigm)
Private Clones OST213584 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000439990 (Chr8:113443822..113444005 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGAGAGCGGTGAAGCTA Chr8:113443860..113443879 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000439990 (Chr8:113443822..113444005 +)
Downstram Exon
ENSMUSE00000310174 (Chr8:113480658..113481950 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGAGAGCGGTGAAGCTA Chr8:113443860..113443879 60.16 55 TGCTTCTAGGGTGAGGCTGT Chr8:113480761..113480780 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439990 Chr8:113443822..113444005 ACTGGAGAGCGGTGAAGCTA Chr8:113443860..113443879 60.16 55

*** Putative Vector Insertion (Chr 8: 113444006 - 113480657) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310174 Chr8:113480658..113481950 TGCTTCTAGGGTGAGGCTGT Chr8:113480761..113480780 60.01 55
downstream ENSMUSE00000212665 Chr8:113486069..113486262 CAGCACTTCGTTGGTGTTGT Chr8:113486116..113486135 59.79 50
downstream ENSMUSE00000310161 Chr8:113491317..113491496 GCTGGCAATCCACATTAGGT Chr8:113491473..113491492 59.96 50
downstream ENSMUSE00000310155 Chr8:113493088..113493133 TTTGTCCACTCGAAGGAAGG Chr8:113493130..113493149 60.22 50
downstream ENSMUSE00000310144 Chr8:113493444..113493563 GGCTGGGTTGTAAATCTGGA Chr8:113493467..113493486 59.93 50
downstream ENSMUSE00000720465 Chr8:113493444..113493723 GGCTGGGTTGTAAATCTGGA Chr8:113493467..113493486 59.93 50
downstream ENSMUSE00000351245 Chr8:113494002..113496380 GAGAAGCACCTTGCATGTGA Chr8:113494667..113494686 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGGAACTCCTGGGAACTG Chr8:113446980..113447000 61.02 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGCAGTACCAGCGTGACT Chr8:113447043..113447064 59.95 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031749