Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24610
Trapped Gene
Cog5 (ENSMUSG00000035933)
Vector Insertion
Chr 12: 32554395 - 32554936
Public Clones not available
Private Clones OST213102 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433760 (Chr12:32554284..32554394 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTGGTGAACTCCCTGTT Chr12:32554350..32554369 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433760 (Chr12:32554284..32554394 +)
Downstram Exon
ENSMUSE00000433751 (Chr12:32554937..32554999 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTGGTGAACTCCCTGTT Chr12:32554350..32554369 59.86 55 ATTATGGTTTGCTCGGCTGT Chr12:32554989..32555008 59.6 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434203 Chr12:32339734..32339848 CCAACATGGAAGGTGGAGAC Chr12:32339750..32339769 60.36 55
upstream ENSMUSE00000434181 Chr12:32345582..32345721 AACTTGCCCAAGGGATCAGT Chr12:32345675..32345694 60.88 50
upstream ENSMUSE00000434177 Chr12:32350330..32350387 CACAAGCAACTGGGATTGAG Chr12:32350358..32350377 59.29 50
upstream ENSMUSE00000434174 Chr12:32354635..32354689 TGATGCAGACGAGAATTGGA Chr12:32354647..32354666 60.35 45
upstream ENSMUSE00000434170 Chr12:32355181..32355250 GCACAACTGGCAAGACTTCA Chr12:32355230..32355249 60.03 50
upstream ENSMUSE00000434164 Chr12:32370518..32370638 TAAGAGGCTCCAGGGACAAC Chr12:32370565..32370584 59.28 55
upstream ENSMUSE00000434151 Chr12:32445712..32445842 AAACCAAGCTAAGCGTCTGC Chr12:32445800..32445819 59.66 50
upstream ENSMUSE00000434144 Chr12:32475712..32475877 CCATAACCTCGGGACTTTGA Chr12:32475747..32475766 59.93 50
upstream ENSMUSE00000434136 Chr12:32486848..32486960 CCCTCTGGACCAATATGGAA Chr12:32486905..32486924 59.74 50
upstream ENSMUSE00000434130 Chr12:32487271..32487348 TCCTGTTTCTCACATTTGTTTCA Chr12:32487309..32487331 59.64 34.78
upstream ENSMUSE00000434124 Chr12:32504990..32505071 GTCACCCTGGCACTTTCTTC Chr12:32505029..32505048 59.7 55
upstream ENSMUSE00000434118 Chr12:32518047..32518251 CCACACATGGAAGACGACAC Chr12:32518196..32518215 60.01 55
upstream ENSMUSE00000434114 Chr12:32522060..32522221 CTATCACGCCTCTTCGATCC Chr12:32522121..32522140 59.8 55
upstream ENSMUSE00000433765 Chr12:32524620..32524719 AAATGTGGCAAAGACCATCC Chr12:32524671..32524690 59.8 45
upstream ENSMUSE00000433760 Chr12:32554284..32554394 GGTGTGGTGAACTCCCTGTT Chr12:32554350..32554369 59.86 55

*** Putative Vector Insertion (Chr 12: 32554395 - 32554936) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000433751 Chr12:32554937..32554999 ATTATGGTTTGCTCGGCTGT Chr12:32554989..32555008 59.6 45
downstream ENSMUSE00000319756 Chr12:32571070..32571173 GCATTCCCCATAAGATCGTG Chr12:32571098..32571117 60.3 50
downstream ENSMUSE00000319748 Chr12:32578836..32579073 TTTCCCACCTTCACCAAGAG Chr12:32579049..32579068 60.08 50
downstream ENSMUSE00000433730 Chr12:32585762..32585838 TCCGATAGGACTTTCCCAGA Chr12:32585825..32585844 59.62 50
downstream ENSMUSE00000433725 Chr12:32604516..32604642 CAGCTGGTGCTCTTGTGAAC Chr12:32604625..32604644 59.62 55
downstream ENSMUSE00000433720 Chr12:32605419..32605498 AGAAGCGAGCATGAGACCAT Chr12:32605449..32605468 59.98 50
downstream ENSMUSE00000434190 Chr12:32610510..32610656 CTTTGGACGGGTCTGTTCAT Chr12:32610659..32610678 59.97 50
downstream ENSMUSE00000433715 Chr12:32622042..32622495 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGTGGTGAACTCCCTGTT Chr12:32554351..32554371 59.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGTGGTGAACTCCCTGTT Chr12:32554351..32554371 59.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035933