Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24635
Trapped Gene
2610109H07Rik (ENSMUSG00000029005)
Vector Insertion
Chr 4: 147487015 - 147489667
Public Clones not available
Private Clones OST212028 (lexicon)
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000447643 (Chr4:147489668..147490109 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACGTGGCAGAGAACACA Chr4:147489701..147489720 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000447643 (Chr4:147489668..147490109 -)
Downstram Exon
ENSMUSE00000447626 (Chr4:147486821..147487014 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACGTGGCAGAGAACACA Chr4:147489701..147489720 59.88 50 AGGATCCGGGACTCTTCTGT Chr4:147486824..147486843 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447651 Chr4:147504682..147504788 No primer for this exon
upstream ENSMUSE00000447643 Chr4:147489668..147490109 GAAACGTGGCAGAGAACACA Chr4:147489701..147489720 59.88 50

*** Putative Vector Insertion (Chr 4: 147487015 - 147489667) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000447626 Chr4:147486821..147487014 AGGATCCGGGACTCTTCTGT Chr4:147486824..147486843 60.07 55
downstream ENSMUSE00000447621 Chr4:147484154..147484265 TTCTTTGCAGAAGGCCAGAC Chr4:147484137..147484156 60.52 50
downstream ENSMUSE00000184423 Chr4:147483731..147483820 CAATCCTGGTGATGGTCACA Chr4:147483717..147483736 60.38 50
downstream ENSMUSE00000184427 Chr4:147482044..147482133 CATGCAGTCGTCGAAACATT Chr4:147482032..147482051 59.72 45
downstream ENSMUSE00000184421 Chr4:147472547..147476691 TAAACCGCTCTCCAGCTTGT Chr4:147476393..147476412 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000029005