Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24645
Trapped Gene
Plvap (ENSMUSG00000034845)
Vector Insertion
Chr 8: 74030818 - 74030918
Public Clones not available
Private Clones OST211455 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000330894 (Chr8:74030919..74030976 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000330894 (Chr8:74030919..74030976 -)
Downstram Exon
ENSMUSE00000330885 (Chr8:74030736..74030817 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAGCAGGGTTGACTACAGG Chr8:74030723..74030742 60.85 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000330923 Chr8:74035250..74035651 TCGTGTCGCTCATTCAGTTC Chr8:74035508..74035527 59.99 50
upstream ENSMUSE00000330913 Chr8:74032363..74032459 CAGGAACAGCTGAAGGAGGT Chr8:74032380..74032399 59.45 55
upstream ENSMUSE00000330904 Chr8:74031500..74032206 ACCCGTGAGAATGCAGAACT Chr8:74031768..74031787 59.73 50
upstream ENSMUSE00000330894 Chr8:74030919..74030976 No primer for this exon

*** Putative Vector Insertion (Chr 8: 74030818 - 74030918) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000330885 Chr8:74030736..74030817 GCAGCAGGGTTGACTACAGG Chr8:74030723..74030742 60.85 60
downstream ENSMUSE00000682485 Chr8:74030570..74030573 No primer for this exon
downstream ENSMUSE00000395537 Chr8:74021666..74022304 CCGGAACGCTCATCTACAAT Chr8:74021729..74021748 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGGTTCCACACCCTAATC Chr8:74030862..74030882 59.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACCCATTGGTGAGTAACA Chr8:74030907..74030927 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034845