Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24669
Trapped Gene
5730601F06Rik (ENSMUSG00000060510)
Vector Insertion
Chr 9: 20305398 - 20306484
Public Clones not available
Private Clones OST210726 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441248 (Chr9:20306485..20306565 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTAGTCTGACCCCCTGGT Chr9:20306530..20306549 60.9 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441248 (Chr9:20306485..20306565 -)
Downstram Exon
ENSMUSE00000472341 (Chr9:20305318..20305397 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTAGTCTGACCCCCTGGT Chr9:20306530..20306549 60.9 60 CTGTTGCACTGGAACTTTGC Chr9:20305301..20305320 59.49 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441314 Chr9:20325788..20325861 CGAGCTCTGAGTCCTTCTCG Chr9:20325832..20325851 60.42 60
upstream ENSMUSE00000441300 Chr9:20325464..20325563 TTTTCGCCATTGGTATCACA Chr9:20325533..20325552 59.93 40
upstream ENSMUSE00000441294 Chr9:20312463..20312629 CTCTGCTCATGCCTACCACA Chr9:20312563..20312582 60.01 55
upstream ENSMUSE00000441285 Chr9:20311172..20311326 CAGGCACATTTCACCATCAG Chr9:20311206..20311225 60.11 50
upstream ENSMUSE00000441280 Chr9:20310421..20310509 AGGTAGACGGGACGGTGACT Chr9:20310445..20310464 60.96 60
upstream ENSMUSE00000539191 Chr9:20309496..20309622 ACCTTCGATGATGTGGCTGT Chr9:20309594..20309613 60.54 50
upstream ENSMUSE00000441248 Chr9:20306485..20306565 TCCTAGTCTGACCCCCTGGT Chr9:20306530..20306549 60.9 60

*** Putative Vector Insertion (Chr 9: 20305398 - 20306484) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000472341 Chr9:20305318..20305397 CTGTTGCACTGGAACTTTGC Chr9:20305301..20305320 59.49 50
downstream ENSMUSE00000441241 Chr9:20304121..20304921 TGACTTTGCATGCTCACCTC Chr9:20304772..20304791 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTTTGCATAATCGCCTTGC Chr9:20306421..20306441 60.6 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGTGCTGTTCCTCAACGTG Chr9:20306480..20306501 60.34 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060510