Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24674
Trapped Gene
Rad23a (ENSMUSG00000003813)
Vector Insertion
Chr 8: 87362855 - 87364392
Public Clones not available
Private Clones OST210343 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720325 (Chr8:87364393..87364540 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720325 (Chr8:87364393..87364540 -)
Downstram Exon
ENSMUSE00000264086 (Chr8:87362693..87362854 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456668 Chr8:87364393..87364540 No primer for this exon
upstream ENSMUSE00000720325 Chr8:87364393..87364540 No primer for this exon

*** Putative Vector Insertion (Chr 8: 87362855 - 87364392) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264086 Chr8:87362693..87362854 No primer for this exon
downstream ENSMUSE00000264060 Chr8:87362368..87362549 No primer for this exon
downstream ENSMUSE00000211788 Chr8:87362172..87362227 No primer for this exon
downstream ENSMUSE00000264009 Chr8:87361906..87362033 No primer for this exon
downstream ENSMUSE00000211784 Chr8:87361588..87361666 No primer for this exon
downstream ENSMUSE00000263944 Chr8:87361359..87361492 No primer for this exon
downstream ENSMUSE00000681486 Chr8:87361359..87361489 No primer for this exon
downstream ENSMUSE00000211795 Chr8:87359654..87359818 No primer for this exon
downstream ENSMUSE00000211793 Chr8:87358551..87359573 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCAAGATCCGCATGGAAC Chr8:87364402..87364422 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCAAGATCCGCATGGAAC Chr8:87364402..87364422 60.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003813