Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24675
Trapped Gene
Mycn (ENSMUSG00000037169)
Vector Insertion
Chr 12: 12944417 - 12946415
Public Clones not available
Private Clones OST210340 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229901 (Chr12:12946416..12947292 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCACTCCTAATCCGGTCA Chr12:12946866..12946885 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229901 (Chr12:12946416..12947292 -)
Downstram Exon
ENSMUSE00000397736 (Chr12:12942905..12944416 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCACTCCTAATCCGGTCA Chr12:12946866..12946885 60.06 55 CTAATACTGGCCGCAAGAGC Chr12:12943321..12943340 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656006 Chr12:12948442..12948642 No primer for this exon
upstream ENSMUSE00000229901 Chr12:12946416..12947292 CCTCACTCCTAATCCGGTCA Chr12:12946866..12946885 60.06 55

*** Putative Vector Insertion (Chr 12: 12944417 - 12946415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397736 Chr12:12942905..12944416 CTAATACTGGCCGCAAGAGC Chr12:12943321..12943340 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCACCTCCGGAGAGGATAC Chr12:12946428..12946448 60.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCGGAGAGGATACCTTGA Chr12:12946423..12946443 59.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037169