Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24688
Trapped Gene
Pfdn5 (ENSMUSG00000001289)
Vector Insertion
Chr 15: 102159249 - 102161703
Public Clones IST12151E2BBR1 (tigm)
Private Clones OST209870 (lexicon) OST201733 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000133099 (Chr15:102159143..102159248 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000133099 (Chr15:102159143..102159248 +)
Downstram Exon
ENSMUSE00000283367 (Chr15:102161704..102161918 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368771 Chr15:102156610..102156691 No primer for this exon
upstream ENSMUSE00000133103 Chr15:102156864..102156966 No primer for this exon
upstream ENSMUSE00000133101 Chr15:102157249..102157280 No primer for this exon
upstream ENSMUSE00000133104 Chr15:102158953..102159027 No primer for this exon
upstream ENSMUSE00000133099 Chr15:102159143..102159248 No primer for this exon

*** Putative Vector Insertion (Chr 15: 102159249 - 102161703) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000283367 Chr15:102161704..102161918 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATGAAGCAGGGTAAGTT Chr15:102159237..102159257 59.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr15:102159296..102159316 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001289