Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24703
Trapped Gene
Mettl5 (ENSMUSG00000051730)
Vector Insertion
Chr 2: 69719469 - 69723305
Public Clones IST12630B12 (tigm) IST11867F3 (tigm) IST11007B6 (tigm) IST10653C12 (tigm)
IST10111H12 (tigm) IST11007B6 (tigm) IST11109D6 (tigm) IST12060H8 (tigm)
IST11260H9 (tigm) IST11063C4 (tigm) IST12630B12 (tigm) IST10111H12 (tigm)
IST14740G11 (tigm) IST14937E8 (tigm) IST11063C4 (tigm) IST12372H12 (tigm)
IST14740G11 (tigm) IST14481E6 (tigm) IST14481E6 (tigm)
Private Clones OST209482 (lexicon) OST67456 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644731 (Chr2:69723306..69723654 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644731 (Chr2:69723306..69723654 -)
Downstram Exon
ENSMUSE00000372008 (Chr2:69719354..69719468 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55 GCAACCGCTTTGTTTTCAAT Chr2:69719389..69719408 60.12 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644731 Chr2:69723306..69723654 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000690970 Chr2:69723306..69723661 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55

*** Putative Vector Insertion (Chr 2: 69719469 - 69723305) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372008 Chr2:69719354..69719468 GCAACCGCTTTGTTTTCAAT Chr2:69719389..69719408 60.12 40
downstream ENSMUSE00000414234 Chr2:69718824..69719005 GTCCCAAAGGGAGGATTCATA Chr2:69718816..69718836 60.14 47.62
downstream ENSMUSE00000333101 Chr2:69717159..69717241 CCATTCCCAAAGCAGTCTTC Chr2:69717181..69717200 59.67 50
downstream ENSMUSE00000690969 Chr2:69715805..69717241 ACCCTCGGATGAGTGAGATG Chr2:69716770..69716789 60.07 55
downstream ENSMUSE00000690974 Chr2:69711941..69711992 TGACTTTCCATTCAGCAGCTT Chr2:69711937..69711957 60.01 42.86
downstream ENSMUSE00000690972 Chr2:69709789..69709838 No primer for this exon
downstream ENSMUSE00000690971 Chr2:69709271..69709373 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCCAGTTTAATCGCCTTG Chr2:69723243..69723263 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGTTTTGGACACGTGACTG Chr2:69720246..69720267 60.06 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGACCAGCTAGAGGCATACG Chr2:69723620..69723640 59.86 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTAGTGTCGTGACTGGGAAAAC Chr2:69723589..69723611 59.15 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051730