Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2471
Trapped Gene
Fbxo21 (ENSMUSG00000032898)
Vector Insertion
Chr 5: 118428003 - 118429749
Public Clones XT0772 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000291191 (Chr5:118427867..118428002 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGCGGTTCTTTTCAGAG Chr5:118427980..118427999 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000291191 (Chr5:118427867..118428002 +)
Downstram Exon
ENSMUSE00000291184 (Chr5:118429750..118429844 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGCGGTTCTTTTCAGAG Chr5:118427980..118427999 59.99 50 CACACCAGCTCATCCTCAAA Chr5:118429826..118429845 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000380120 Chr5:118426801..118427048 TGCTGGAGTACATCCTGTGC Chr5:118426919..118426938 59.86 55
upstream ENSMUSE00000291191 Chr5:118427867..118428002 CCAAGCGGTTCTTTTCAGAG Chr5:118427980..118427999 59.99 50

*** Putative Vector Insertion (Chr 5: 118428003 - 118429749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000291184 Chr5:118429750..118429844 CACACCAGCTCATCCTCAAA Chr5:118429826..118429845 59.83 50
downstream ENSMUSE00000291179 Chr5:118436108..118436229 GGAACGCCTTGAGGTTATTG Chr5:118436196..118436215 59.57 50
downstream ENSMUSE00000291172 Chr5:118438787..118438933 GGGTTGCAGTACTGGTCGAT Chr5:118438820..118438839 60 55
downstream ENSMUSE00000291166 Chr5:118439133..118439269 TTGATAGCGTCCAGCACTTG Chr5:118439193..118439212 60.01 50
downstream ENSMUSE00000291159 Chr5:118440812..118440948 AGGAAGTGGCTTGGGAAGTT Chr5:118440924..118440943 60.11 50
downstream ENSMUSE00000291151 Chr5:118444491..118444670 CATCCGCTGTAGCACCTTCT Chr5:118444644..118444663 60.42 55
downstream ENSMUSE00000291145 Chr5:118445379..118445511 GATGCCCAGGTGGAAGTAGA Chr5:118445502..118445521 60.07 55
downstream ENSMUSE00000291138 Chr5:118450326..118450537 CTGGAGGATGTCAAGCACCT Chr5:118450367..118450386 60.26 55
downstream ENSMUSE00000291132 Chr5:118452024..118452181 GGACGTTGTAGAAGGGCTGA Chr5:118452148..118452167 60.26 55
downstream ENSMUSE00000385255 Chr5:118458019..118460199 CCGAGGCTGCTTAGTACTGG Chr5:118459751..118459770 60.03 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCCGGAAGATTGTAGCTT Chr5:118427955..118427975 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCCGGAAGATTGTAGCTT Chr5:118427955..118427975 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032898