Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24720
Trapped Gene
Cox7a2 (ENSMUSG00000032330)
Vector Insertion
Chr 9: 79603413 - 79604083
Public Clones not available
Private Clones OST209067 (lexicon) OST186312 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218754 (Chr9:79604084..79604168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGGGATGCCAGTTCATCT Chr9:79604143..79604162 59.37 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218754 (Chr9:79604084..79604168 -)
Downstram Exon
ENSMUSE00000225376 (Chr9:79603215..79603412 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGGGATGCCAGTTCATCT Chr9:79604143..79604162 59.37 45 CGAGCGTTGATGAAACTGAA Chr9:79603287..79603306 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225455 Chr9:79607447..79607520 AAGATGTTGCGGAATCTGCT Chr9:79607448..79607467 59.84 45
upstream ENSMUSE00000218755 Chr9:79606297..79606386 CCACTTCACGAAGGCATTTT Chr9:79606333..79606352 60.11 45
upstream ENSMUSE00000218754 Chr9:79604084..79604168 AATGGGATGCCAGTTCATCT Chr9:79604143..79604162 59.37 45

*** Putative Vector Insertion (Chr 9: 79603413 - 79604083) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000225376 Chr9:79603215..79603412 CGAGCGTTGATGAAACTGAA Chr9:79603287..79603306 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTGATGCCCTCCTCTACA Chr9:79604109..79604130 60.22 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCGTGACTGGGAAAACC Chr9:79604016..79604036 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032330