Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24727
Trapped Gene
Gss (ENSMUSG00000027610)
Vector Insertion
Chr 2: 155404165 - 155404447
Public Clones not available
Private Clones OST208929 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171099 (Chr2:155404448..155404523 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACGACTATACTGCCCGTCT Chr2:155404491..155404511 60.53 57.14 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171099 (Chr2:155404448..155404523 -)
Downstram Exon
ENSMUSE00000171085 (Chr2:155404025..155404164 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACGACTATACTGCCCGTCT Chr2:155404491..155404511 60.53 57.14 TCGATCTGTTTCAGGGCTTT Chr2:155404063..155404082 59.81 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639694 Chr2:155418430..155418466 No primer for this exon
upstream ENSMUSE00000324830 Chr2:155413178..155413312 AGCTCGAAGAACTGGCAAAG Chr2:155413247..155413266 59.76 50
upstream ENSMUSE00000171100 Chr2:155407624..155407769 GCTGTGCAGATGGACTTCAA Chr2:155407681..155407700 59.99 50
upstream ENSMUSE00000171099 Chr2:155404448..155404523 GGACGACTATACTGCCCGTCT Chr2:155404491..155404511 60.53 57.14

*** Putative Vector Insertion (Chr 2: 155404165 - 155404447) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171085 Chr2:155404025..155404164 TCGATCTGTTTCAGGGCTTT Chr2:155404063..155404082 59.81 45
downstream ENSMUSE00000171081 Chr2:155403258..155403374 AGTCCCTTGCTGGGGTTATT Chr2:155403281..155403300 59.83 50
downstream ENSMUSE00000171087 Chr2:155398831..155398911 GCACGCTGGTCAAATATGTTC Chr2:155398833..155398853 60.53 47.62
downstream ENSMUSE00000171080 Chr2:155398660..155398737 CTTCGGTTTTGGTCCAGAGA Chr2:155398647..155398666 60.22 50
downstream ENSMUSE00000171092 Chr2:155397255..155397321 CTCGGAAGTACACCACAGCA Chr2:155397265..155397284 59.9 55
downstream ENSMUSE00000171097 Chr2:155393429..155393623 GCTGTATGGCAATGTCTGGA Chr2:155393535..155393554 59.68 50
downstream ENSMUSE00000171095 Chr2:155392539..155392620 AAGTGGCTAGGAGCAGCAAG Chr2:155392546..155392565 59.78 55
downstream ENSMUSE00000171089 Chr2:155390496..155390685 TGTACCATTTCCTCCCCGTA Chr2:155390633..155390652 60.18 50
downstream ENSMUSE00000368457 Chr2:155388923..155389455 AGGCACTAGAACCTGCTGGA Chr2:155388988..155389007 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGTCTGGCCCTTGTCTC Chr2:155404407..155404427 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGTCTGGCCCTTGTCTC Chr2:155404407..155404427 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027610