Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24737
Trapped Gene
Gin1 (ENSMUSG00000026333)
Vector Insertion
Chr 1: 99673902 - 99674097
Public Clones not available
Private Clones OST208507 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693388 (Chr1:99673903..99674716 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTACTGGACGTCCGTGACC Chr1:99674059..99674078 60.03 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693388 (Chr1:99673903..99674716 +)
Downstram Exon
ENSMUSE00000158130 (Chr1:99673903..99674096 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTACTGGACGTCCGTGACC Chr1:99674059..99674078 60.03 60 ACGGACGTCCAGTAGTAGCC Chr1:99674077..99674096 59.24 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706938 Chr1:99666745..99666832 AACCTGCCGTTTGCACTTAG Chr1:99666803..99666822 60.31 50
upstream ENSMUSE00000693398 Chr1:99666756..99666832 AACCTGCCGTTTGCACTTAG Chr1:99666803..99666822 60.31 50
upstream ENSMUSE00000597881 Chr1:99666774..99666832 AACCTGCCGTTTGCACTTAG Chr1:99666803..99666822 60.31 50
upstream ENSMUSE00000158134 Chr1:99672024..99672169 TAAGCGCACAGGGGAATATC Chr1:99672084..99672103 60.06 50
upstream ENSMUSE00000709792 Chr1:99672024..99672169 TAAGCGCACAGGGGAATATC Chr1:99672084..99672103 60.06 50

*** Putative Vector Insertion (Chr 1: 99673902 - 99674097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158130 Chr1:99673903..99674096 ACGGACGTCCAGTAGTAGCC Chr1:99674077..99674096 59.24 60
downstream ENSMUSE00000693388 Chr1:99673903..99674716 AGCCATACCCACTGCTTGAC Chr1:99674107..99674126 60.14 55
downstream ENSMUSE00000693397 Chr1:99679504..99679809 GGAAAGGTCCCATCAGATCA Chr1:99679627..99679646 59.86 50
downstream ENSMUSE00000659722 Chr1:99679771..99679809 TGAATTCATCTCTTTGGTCCATT Chr1:99679801..99679823 59.83 34.78
downstream ENSMUSE00000158132 Chr1:99681330..99681521 CACTTCCAGAAGCACGAGAA Chr1:99681399..99681418 59.16 50
downstream ENSMUSE00000283355 Chr1:99681632..99681799 CGCCATCAGCCTCTCTAATC Chr1:99681770..99681789 59.94 55
downstream ENSMUSE00000158135 Chr1:99682553..99682835 GGCCTAAGGTGGGACATTTT Chr1:99682812..99682831 60.19 50
downstream ENSMUSE00000158129 Chr1:99688874..99690286 CGTGATCTGCCACTATCGAA Chr1:99688918..99688937 59.82 50
downstream ENSMUSE00000693395 Chr1:99688874..99689342 GTCGTGATCTGCCACTATCG Chr1:99688920..99688939 59.27 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGTTAATCGCCTTGCAG Chr1:99673947..99673967 61.12 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAATCGTTTGGTCGTGACTG Chr1:99673940..99673961 60.02 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026333