Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24763
Trapped Gene
Naca (ENSMUSG00000061315)
Vector Insertion
Chr 10: 127485184 - 127485300
Public Clones not available
Private Clones OST207543 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000505712 (Chr10:127485055..127485183 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCGTCCAAGAGGAGAGTGA Chr10:127485154..127485173 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000505712 (Chr10:127485055..127485183 +)
Downstram Exon
ENSMUSE00000509865 (Chr10:127485301..127485423 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCGTCCAAGAGGAGAGTGA Chr10:127485154..127485173 59.83 55 ACTTCCACACCCGTCTCATC Chr10:127485326..127485345 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485964 Chr10:127472701..127472739 ATCTTGGTTCCGTGATCTCC Chr10:127472715..127472734 58.94 50
upstream ENSMUSE00000273294 Chr10:127473545..127473616 ACAGAAACCGTCCCTGCTAC Chr10:127473562..127473581 59.21 55
upstream ENSMUSE00000573195 Chr10:127476227..127482142 GCTGCAACTCCCAAAGAGAC Chr10:127478794..127478813 60 55
upstream ENSMUSE00000481992 Chr10:127483224..127483309 CCAGAGCTCGAGGAACAAGA Chr10:127483259..127483278 60.67 55
upstream ENSMUSE00000476151 Chr10:127483785..127483862 AAAGCCAAGCAGAGTCGAAG Chr10:127483824..127483843 59.76 50
upstream ENSMUSE00000477920 Chr10:127484714..127484860 ATGTCCAAACTGGGTCTTCG Chr10:127484717..127484736 59.97 50
upstream ENSMUSE00000505712 Chr10:127485055..127485183 ACCGTCCAAGAGGAGAGTGA Chr10:127485154..127485173 59.83 55

*** Putative Vector Insertion (Chr 10: 127485184 - 127485300) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000509865 Chr10:127485301..127485423 ACTTCCACACCCGTCTCATC Chr10:127485326..127485345 59.97 55
downstream ENSMUSE00000335588 Chr10:127485549..127485688 GAAAGGGGGAGTTGTCTTCG Chr10:127485597..127485616 60.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCGTCCAAGAGGAGAGTGA Chr10:127485155..127485175 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCGTCCAAGAGGAGAGTGA Chr10:127485155..127485175 59.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061315